More Fields
Strain Species Genotype
RB1928 C. elegans exoc-8(ok2523) I. Show Description
Y105E8B.2. Homozygous. Outer Left Sequence: CTACCGACTGAGCTATCCGC. Outer Right Sequence: AAATTTCATGGCGTTTTTGG. Inner Left Sequence: TTTCGCAAAATGCACAACAT. Inner Right Sequence: GCCCCAGTCAACGTTAAAGA. Inner Primer PCR Length: 2583 bp. Deletion Size: 1474 bp. Deletion left flank: TTAAAAATGAACAAATTTTTTGGAAAATCT. Deletion right flank: TCACAGTTTGCCGTTTTCCTCGAATAGTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1965 C. elegans Y105E8A.12(ok2585) I. Show Description
Y105E8A.12 Homozygous. Outer Left Sequence: cccgatcatcccaagattta. Outer Right Sequence: gctccaatgcgaatttgttt. Inner Left Sequence: ccaaatttgtactcgacccg. Inner Right Sequence: catcgattttgggaatcagg. Inner Primer PCR Length: 3158. Deletion size: about 2200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2080 C. elegans Y50E8A.9(ok2746) V. Show Description
Y50E8A.9 Homozygous. Outer Left Sequence: cgcaacagcaaaacgttaga. Outer Right Sequence: atgtgtttgtgcatgcctgt. Inner Left Sequence: tggacgaaaatcatggtgaa. Inner Right Sequence: ctaccttctaggcgacaccg. Inner Primer PCR Length: 1249. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3300 C. elegans npl-4.2(ve800[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1752 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAAAATCTATTTTATTTCAGATATGGTA ; Right flanking sequence: ACATTCCAAAACGAAGCAGGAAGACAGGAT. sgRNA #1: CGTTGACACGCTCAGTTTGA; sgRNA #2: ACAGTGTCCACAGCTCCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3301 C. elegans vps-25(ve801[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1 [unc-54(h1040)] I. Show Description
Late larval arrest. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear arrested L4 larvae (ve801 homozygotes) and non-GFP Unc animals (hIn1[unc-54(h1040)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CAAATAAATTTAACGCCTTCATTATCTCCA ; Right flanking sequence: CGGCctgaaaaatgcgtaattccctgaaaa. sgRNA #1: GCTCAATTGATGAATATCGG; sgRNA #2: TGACACCGTCGGTTGAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3302 C. elegans K10H10.6(ve802[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttggctagagtcaacccaacgctccgccc ; Right flanking sequence: CCGCGCCGTCCAGAATTGTAATACTTTCTT. sgRNA #1: tcgaaaagagggaggtgagt; sgRNA #2: AGAGTCGAACCACTGGAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3303 C. elegans trmt-10A(ve803[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
F25H8.1. Homozygous viable. Deletion of 1172 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gggtgtaattttaaaatatgaaaatgaTTA ; Right flanking sequence: atttagaatatattttttaatgttttcaaa. sgRNA #1: ATTTATTTTAGGAGAGCCCG; sgRNA #2: atcattttggcatctttaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3304 C. elegans F27D9.2(ve804[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 3038 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGAAATGGGAGGAGACACGATTGAAACAG ; Right flanking sequence: TGGATTATATTGCGTGTGAGAATGGTTCCA. sgRNA #1: GAGAGAAAATTCTAGATGAC; sgRNA #2: TGGTAGTCCTTATTAGTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3305 C. elegans F20D1.3(ve805[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATATGCAGCAACTTAAGAtttttttttCA ; Right flanking sequence: TATCCAACTCAGAAGAAGAAGAAGAGCTGC. sgRNA #1: GATTTGGCGCATCAACTGCA; sgRNA #2: GTAGGCATTCTGTCCATCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3306 C. elegans F40A3.3(ve806[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 757 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ataaaaaaataaatTAAGGATGGTCGTCCT ; Right flanking sequence: CGGAGCATGAGTTGTTCTTCTGTAAAATTG. sgRNA #1: GGAGCAGAGATCTCGTTACC; sgRNA #2: CCAATTCTCAACAAGCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3307 C. elegans +/nT1[umnIs49] IV; xpo-1(ve807[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3308 C. elegans C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. Show Description
tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3309 C. elegans egrh-2(ve809[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 5538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCTATCGGTTCGCAAATGTCATTACCG ; Right flanking sequence: cccACTTTTAATCTGAAATTTTGTATAAAA. sgRNA #1: GTGTGTCGGAGGAAGAAACA; sgRNA #2: aaattgctttaatgcctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3310 C. elegans C28F5.4(ve810[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2762 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTCTTTCGTGATTCTTTTTGAAATGCCA ; Right flanking sequence: TTCCTAAGAAGAGCATATGCTCGCAGAAGT. sgRNA #1: GGACGCAATAAAGAAGTGCG; sgRNA #2: CTGCCAAATATCCGTCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3311 C. elegans fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+. Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3312 C. elegans gdh-1(ve812[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49]IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve812 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTTAATTACAAAATATTTTATTTTCAGGTA ; Right flanking sequence: GTACCCACTTCTCACTCATCTCATGGCTCT. sgRNA #1: ATGTTGAGCACTCTTTCCAG; sgRNA #2: TTATGTGAAGGTGAATCCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3313 C. elegans arrd-4(ve813[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCAACGTTGACCTTCAAAGCAGTAGCTTC ; Right flanking sequence: cggcagtttgctgcaacttattgcccaacc. sgRNA #3: TCCAATGCAGTTGCTTGAGT; sgRNA #4: acctcgtcgtttcagccaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3314 C. elegans asp-19(ve814[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 521 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAAAACCTAGACCAACAATGGTTGCAATT ; Right flanking sequence: AGTGCATCTCATGAAAAAAATAGAGACGGG. sgRNA #1: ACCATTACAAAGCAAGAGCT; sgRNA #2: TGCTGTTTTGTAGCTCACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3315 C. elegans gpd-4(ve815[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTCATTCAAGTTTTCTTACAGACTCAAA ; Right flanking sequence: TGGAGCATGCATTTCGCTCAACCCGAACTT. sgRNA #1: AAAATGTCGAAAGCCAACGT; sgRNA #2: GTATCGAAAATGGACGAGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3316 C. elegans lrp-1(ve816[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3317 C. elegans F44E5.5(ve817[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2259 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGAGAAAAAGAAAGAGGGAGACAGAGTG ; Right flanking sequence: AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA #1: TCTAGAAGATGTTACGGGAA; sgRNA #2: AACAGGCATACATTAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3318 C. elegans +/mT1 [umnIs52] II; prx-10&wrs-2(ve818[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest/sterile. Deletion of 3348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae/sterile adults (ve818 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCAGCGAAGAGATGAAGAGTATATTGAAGA ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: TATTACAGAAAGATTGAGCA; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3319 C. elegans +/mT1 [umnIs52] II; wrs-2(ve819[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve819 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGTTGATCAACACGCTATTTCACTTGGACC ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: ACTTCCAGCAAATGAGGTTG; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3320 C. elegans got-1.2(ve820[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1449 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCTTGGCGACATATTCCACGTTTTTCGTGT ; Right flanking sequence: AGGTACATCTTGTTCTTGTGGAACACCTCG. sgRNA #1: TAAGACCACAAATGTTGATG; sgRNA #2: TGACGGGAGCCGTCTCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3321 C. elegans ile-1(ve821[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1699 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAATGCAATAAATTAGTAGAATTTGGCCT ; Right flanking sequence: ATCTGGAATGCAAATGTTTGCTTAGCGAAT. sgRNA #1: TGTACGAAGCAAGCAAGACA; sgRNA #2: TTCCAGATATGACCTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3322 C. elegans got-2.1(ve822[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2683 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCAACTCTGGATTACTCAAAATCCGTGAA ; Right flanking sequence: CGGGAGCACTGGTTGAGCAGTTACAGTAGT. sgRNA #1: GCAATTCTTGCTCCATGAAG; sgRNA #2: AGCGGCACATTTCTGAACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3323 C. elegans ostb-1(ve823[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Emb. Deletion of 1090 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead eggs (ve823 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TGATCTTTGACCATCTCTTCATTCTTGCCC ; Right flanking sequence: TCGTTCTCAATGATGGCGGGACTCGTGTTG. sgRNA #1: TCCGAAGACTTGAACCCCTG; sgRNA #2: AGAGGCGTAGTATGGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3324 C. elegans C34F6.1(ve824[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2843 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AACCATATCGCTTCTCAAAGTTATTGCATG ; Right flanking sequence: GTTGCATGAGATTGGAGTGGAGAATTCGTT. sgRNA #1: GTCCCGAGTCGCGAGCTGAG; sgRNA #2: TACTTGAACCAACCAAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3325 C. elegans W06A7.4(ve825[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1716 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGATTCGGTCTATTTGGTGTACCTTCCG ; Right flanking sequence: CACTTTTCGGAGTTCTTGTTATAACAGCGT. sgRNA #1: TAAAATGCTCATTGGAACGG; sgRNA #2: TGAAGCCGTATGCAGTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3326 C. elegans ZK353.9(ve826[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGCAGAGCACATTCCAGAAGTTCCAGGTGA ; Right flanking sequence: GGGACTTTTCTAAaataattaattattgat. sgRNA #1: TATCGTAGCGATACACGTCA; sgRNA #2: ATTCCAGATGCTGTTGCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3327 C. elegans T06E6.1(ve827[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. Show Description
Homozygous early larval arrest. Deletion of 1416 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+  arrested larvae (ve827 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.  Left flanking Sequence: CGTCGGATGATTTTTTCGCCCTTTTCACCG; Right flanking sequence: AGGTAATCTCATCGCTTTTCGGGTCAAGGG. T06E6.1 sgRNA #1: CGTGTGGGGAGTGATGGAAC; T06E6.1 sgRNA #2: CTCGTCATTCCAGATCATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3328 C. elegans nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II. Show Description
tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+  arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3329 C. elegans dsl-7(ve829[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 749 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACAAATGTTCCAATTGAATTCGATCAACCT ; Right flanking sequence: AGGGGCGACCTGTTAGACTAAATTCACAGT. sgRNA #1: GCAAGTATCATAATAAGAAG; sgRNA #2: ATCCACACCATATTTCCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3330 C. elegans C16C8.18(ve830[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCGAAAATCGGAAGAAAAAGTTCAACGAT ; Right flanking sequence: AAGCTGAAGTCTGTGAAGATTTGATAACTC. sgRNA #1: GATGAGCAGTAGTATCGAAG; sgRNA #2: CTTCTCGAGCAAAAGAGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3331 C. elegans Y8A9A.2(ve831[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4848 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTATTCGAATCTTTTTTATAGGGTACCC ; Right flanking sequence: AGAACTTCTTGCTGTGCTCCATACAAGAAG. sgRNA #1: TGCTTTGAGAAGCATTCTGG; sgRNA #2: TGGGAAGAGACAGACCGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3332 C. elegans skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3333 C. elegans nep-11(ve833[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATATCTTCGAATCTCTCATCCAAGTACCT ; Right flanking sequence: TTTCACTGATAGTTATCAGTTGCATCTGAC. sgRNA #1: GAGTTGTCCAGTCAAACGTG; sgRNA #2: ATAGTGATATACCTACTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3334 C. elegans skr-15(ve834[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 474 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTGCTGCTCCAATCGCCGAAGAAGCCA ; Right flanking sequence: AGGCATCTGCAACTTCTGCTGATACAACTG. sgRNA #1: GCTGTAGTAGACGACTGGGG; sgRNA #2: GTTTGGCAAGGAGAAGACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3335 C. elegans nep-6(ve835[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3709 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTCTGCGAAAGATAAGCTGGCCAATCCT ; Right flanking sequence: ATATGCCACAATTTGCGACAGCATTCAACT. nep-6 sgRNA #1: AACACGACTAGAGCAATCAG; nep-6 sgRNA #2: TGGAAAAGATCCCATTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3336 C. elegans C33A12.3(ve836[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1844 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATATATTGGAAATTTCTAAATTTAAAGCCA ; Right flanking sequence: TGGTCGGTTTGTACCATATTCCACATGACT. C33A12.3 sgRNA #1: GGGCTGGGCACTATTGACAC; C33A12.3 sgRNA #2: TGACGATCTCGAGAAAGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3337 C. elegans vha-18(ve837[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCAGCAGACGCATCATTGCTTCTTTACCA ; Right flanking sequence: TTTGAAACTGAATCAAAGAAAATTAACTTT. vha-18 sgRNA #1: CTTAAAGTGGAACAACTCGG; vha-18 sgRNA #2: CAGTTTCAAAATGGTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3338 C. elegans C25G4.2(ve838[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCTCTCTCATAAATCCGGCAATCTTCTCCT ; Right flanking sequence: AGGCAGAGGATCCGGAGTTTCGGTTGGGAA. C25G4.2 sgRNA #1: ACCGTCGATGTCAAAGCACA; C25G4.2 sgRNA #2: CGCATTGTCGATATCCGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3339 C. elegans ptrg-1(ve839[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3983 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCGATTTTCACCTTCGAGGCAAAAATACCA ; Right flanking sequence: GAACTGAAACTGAAAATCGAAGAATTGGTC. ptp-4 sgRNA #1: TCGTATACCGAAATTCAGTG; ptp-4 sgRNA #2: GCACCGTTTCTGATAACACA. ptrg-1 formerly known as ptp-4. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3341 C. elegans phf-5(ve841[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 2354 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve841 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  Left flanking Sequence: TGTGTGATTTGTGATTCACATGTTCGTCCA; Right flanking sequence: AGGATCGTGACGGATGCCCGAAAATTGTGA. phf-5 sgRNA #3: CAGATACGAACCAATGTACA; phf-5 sgRNA #4: AGAATGCACAATTCTCGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3342 C. elegans xpd-1(ve842[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3343 C. elegans marc-5(ve843[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 6603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGGGTAAGAAGGACCATAAGCCTACTCGAGC ; Right flanking sequence: TGATGCTGCAAAAATTAGAAAAAATACGTGTT. marc-5 sgRNA #1: ACAATCACAGAACTCCGCAG; marc-5 sgRNA #2: TATTTGTCTCAACAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3344 C. elegans Y57G11C.1147(ve844[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve844 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ACGGACGACTCTTCCGGCAGTTGCAGACAT; Right flanking sequence: TCAACGCTGAAAAGCTGAAAAACGGTGAAG. Y57G11C.1147 sgRNA #1: GAGTATCTCCTTTGGTGACA; Y57G11C.1147 sgRNA #2: TCAGCGTTGAATGCACGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3345 C. elegans ppfr-1(ve845[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 5994 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGGATCCATAGGTATATCCAGTTCATCCT ; Right flanking sequence: TAAAATCATCCGATGTGTCTTCCGAAAATG. ppfr-1 sgRNA #1: TGAGAATGTTAAGAATACTG; ppfr-1 sgRNA #2: GAACACTTCCTAAAGATACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3346 C. elegans C25E10.5(ve846[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGTTGATCATTGTCGCTGGAATAGTTTCCG ; Right flanking sequence: TGGCTCATCAAATCATCCGTTTTCTTCGCA. C25E10.5 sgRNA #1: ATTTTCCACGGCATTCAATG; C25E10.5 sgRNA #2: TAGTGGTCCAACTCCCAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3347 C. elegans F59E11.2(ve847[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1484 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGGGTGTTATACTACAAGATCAAGTGGCT ; Right flanking sequence: GGGTAATCTGGCAAAGTGTAAACCGCTTTT. F59E11.2 sgRNA #1: CTTGTCACAGGTGCTTCCCG; F59E11.2 sgRNA #2: ACAAATCAAGCTACCAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.