More Fields
Strain Species Genotype
AG150 C. elegans apc-1(ar104)/unc-4(e120) bli-1(e769) II. Show Description
Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2.
CB3970 C. elegans unc-4(e120) bli-1(e769) II. Show Description
Uncoordinated and Blistered.
CB769 C. elegans bli-1(e769) II. Show Description
Blistered cuticle. Male tale abnormal. M-MATING-NO SUCCESS.
MT20111 C. elegans unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
RG3269 C. elegans F10G8.9(ve769[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.