More Fields
Strain Species Genotype
CB713 C. elegans unc-108(e713) I. Show Description
Unc. M-MATING++ 1-10%WT. Previously called unc-67.
RG3213 C. elegans F48E3.4(ve713[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1703 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agaagtacagagcaaacacaaaatgtgcac ; Right flanking sequence: AGGAAACGATGACCGCTCGAAACATcttct. sgRNA #1: acgaaaatcaatacgttata; sgRNA #2: AAACACGAATGCAAGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.