| BC2507 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) cdc-25.2(s819) dpy-11(e224)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, and dead eggs. Egg lethal. Maintain by picking WT.
|
|
| BC2509 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-408(s827)/eT1 V. Show Description
WT strain that segregates WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT.
|
|
| BC2510 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) let-426(s826) dpy-11(e224)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
| BC2511 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) sDf35/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
|
|
| BC2646 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-410(s815)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
| BC2648 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-409(s823)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
| BC2908 |
C. elegans |
dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-423(s818)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
| CB677 |
C. elegans |
unc-60(e677) V. Show Description
Unc-slow moving. Body muscle abnormal. Semi-dominant. Birefringent patches. Eggs laid. M-MATING-NO SUCCESS.
|
|
| MT4446 |
C. elegans |
unc-34(e566) unc-60(e677) dpy-11(e224) V. Show Description
Dpy. Unc.
|
|
| RG3177 |
C. elegans |
T21B10.3(ve677[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 4525 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adult animals that lay dead eggs (ve677 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gctcgtaacagcaaaATGAATAATCCAGAA ; Right flanking sequence: attgaattcgtatttttttccattccacat. sgRNA #1: TCTGTTACAGCGCTTTCTTC; sgRNA #2: aaaaatacgaattcaatggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RW2306 |
C. elegans |
unc-60(e677) V; sup-12(st89) X. Show Description
Hermaphrodite ovaries are abnormal in morphology and accumulate many mature but unfertilized oocytes.
|
|