| CB2030 |
C. elegans |
unc-62(e644) dpy-11(e224) V. Show Description
UncDpy.
|
|
| CB644 |
C. elegans |
unc-62(e644) V. Show Description
Unc. Recessive. Bursae abnormal. Males abnormal. M-MATING-NO SUCCESS.
|
|
| RG3144 |
C. elegans |
+/mT1[umnIs52] II; T20B12.3(ve644[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve644 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tacgcaaacatgacacctgacgacatttca ; Right flanking sequence: GTGGGAAATTCGCTCCAAAACACGAAGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SD1879 |
C. elegans |
unc-62(e644) V; wgIs600. Show Description
wgIs600 [unc-62::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Derived from parental strains CB644 and SD1871.
|
|
| SD1887 |
C. elegans |
unc-62(e644) V; gaIs286. Show Description
gaIs286 [unc-62(7b)::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. A STOP-codon was inserted into exon 7a of unc-62 to generate an UNC-62(7b)-specific reporter. Recombineered fosmid was integrated by biolistic bombardment to produce strain OP602, which wa outcrossed to produce SD1894. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Gerstein MB, et al. Science. 2010 Dec 24;330(6012):1775-87. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org) Derived from parental strains BC1282 and SD1894.
|
|
| JLF212 |
C. elegans |
par-6(wow31[par-6::ZF::GFP::3xFLAG]) I; zif-1(gk117) III. Show Description
ZF-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Presence of ZF-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged PAR-6 protein to be degraded. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437.
doi: 10.7554/eLife.64437. PMID: 34137371.
|
|