| F18A1.7(ve596[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1089 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acatatttgtgtcgggtgattatttacaat ; Right flanking sequence: aggtcatataaggaaaagaacagctaggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|