Unc. Recessive. M-MATING+++ 10-30%WT.

Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.

Heterozygotes are WT and segregate WT, Roller Uncs, and a few Dpy mT1 homozygotes. mT1 is an apparent II;III translocation: small broods, lots of dead eggs, and exhibits pseudolinkage between rol-1 II and unc-71 III. The Roller phenotype of rol-1 expresses late and cannot be scored before adulthood. Pick non-Unc hermaphrodites and check for correct segregation of progeny.

Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.