Heterozygotes are WT and segregate WT, DpyUncs and dead eggs.

Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx73 [unc-3p::dsUnc-3(RNAi) + myo-2p::GFP]. Pick GFP+ to maintain array. Array carries a construct with the unc-3 promoter driving transcription of a hairpin targeting unc-3 for RNAi depletion in cholinergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx147 [oig-1p(1.6kb)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 1.6kb cis-regulatory region (-2.6-1.0kb) upstream of oig-1 was fused to GFP with the unc-54 3'UTR. oig-1 uses mulitple cis-regulatory regions to achieve different expression patterns in motor neurons; this construct drives expression specifically in cholinergic motor neurons. Construct was injected into N2 worms. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

mNeonGreen::3xFLAG::AID was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.