Search Strains

More Fields
Strain Species Genotype Add
SP802 C. elegans unc-4(e120) mnDf104/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP803 C. elegans unc-4(e120) mnDf105/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP804 C. elegans unc-4(e120) mnDf106/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP806 C. elegans unc-4(e120) mnDf108/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT.
SP807 C. elegans unc-4(e120) mnDf109/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and no viable Unc-4's. Maintain by picking WT. [12/93 **mnC1 appears to have broken down**]
SP940 C. elegans unc-52(e444) II; unc-1(e538) X; mnDp11 (II;X;f). Show Description
Maintain strain by picking WT. Throws WT and Unc.
SS186 C. elegans mes-2(bn11) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.
ST29 C. elegans ven-2(nc29)/mnC1 [dpy-10(e128) unc-52(e444)] II; ncIs3 III. Show Description
ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development.
SV122 C. elegans lin-5(n3070)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3070 is a strong loss-of-function or null allele. Molecular lesion: P to S at position 24 as well as an amber mutation terminating translation after amino acid 52. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
SV123 C. elegans lin-5(n3066)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3066 is a strong loss-of-function or null allele. Molecular lesion: ochre mutation terminating translation at amino acid 538. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
SV13 C. elegans lin-5(e1348)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. Molecular lesion: amber mutation terminating translation at amino acid 159. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
SV314 C. elegans rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.
SV329 C. elegans rol-1(e91) cyd-1(he116)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.
SV46 C. elegans lin-5(e1457)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. e1457 is a strong loss-of-function or null allele. Molecular lesion: G to E at position 40. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
VC2320 C. elegans max-2(ok2553)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Y38F1A.10. Apparent homozygous lethal deletion chromosome balanced by recombination suppressor marked with dpy-10 and unc-52. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok2553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACAGAAATCGACAGCAGG. External right primer: ACGGGAACCCCCATATACTC. Internal left primer: AAGCGGTAAATGACGGAATG. Internal right primer: TGTGTCTGTGTGTCTTCGCA. Internal WT amplicon: 3342 bp. Deletion size: approximately 2000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC274 C. elegans arrd-3(ok536)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
M176.1. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC341 C. elegans hel-1(gk191)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
C26D10.2. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and gk191 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VH7192 C. elegans coa-7 (hd7182 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VT132 C. elegans sqt-1(sc13) lin-29(n333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate more animals which are slightly shorter than WT, Rollers which are Egl and have a protruding vulva, and DpyUncs.
VT516 C. elegans lin-29(n546)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate DpyUnc and Egl.
WM170 C. elegans unc-4(e120) pir-1(tm1496)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496.
AV828 C. elegans nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
AV860 C. elegans nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
GR3149 C elegans mgIs72 II; mgIs78 IV. Show Description
mgIs72 [rpt-3p::GFP + dpy-5(+)] II. mgIs78 [myo-3p::H2B::mCherry::SL2::pbs-5(T65A)] IV. Muscle-specific proteasome dysfunction. Reference: Lehrbach NJ & Ruvkun G. Elife. 2019 Apr 11;8. pii: e44425. doi: 10.7554/eLife.44425.