| ESC332 |
C. elegans |
rpoa-2(cse319[degron::GFP::rpoa-2]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC351 |
C. elegans |
rpoa-2(cse319[degron::GFP::rpoa-2]) I; reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC352 |
C. elegans |
qzIs15[rpoa-2p::degron::GFP::rpoa-2] I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC360 |
C. elegans |
rpoa-2(cse319[degron::GFP::rpoa-2]) I; emcSi71 IV. Show Description
emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC373 |
C. elegans |
rpoa-2(cse319[degron::GFP::rpoa-2]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC374 |
C. elegans |
rpoa-2(cse319[degron::GFP::rpoa-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. Degron and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC424 |
C. elegans |
tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC432 |
C. elegans |
grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the C-terminus of endogenous grwd-1locus. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC440 |
C. elegans |
reSi2 II; tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of TSR-2 in epidermal tissues. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC444 |
C. elegans |
reSi2 II; grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in epidermal tissues. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC716 |
C. elegans |
ida-1(cse716[ida-1:: wrmScarlet]) III. Show Description
mScarlet tag inserted into the C-terminus of the endogenous ida-1 locus. Maintain at 16-20C. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| GE3023 |
C. elegans |
emb-8(t1533) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| IG1839 |
C. elegans |
frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
|
|
| IG1846 |
C. elegans |
frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
|
|
| IG358 |
C. elegans |
oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Pick GFP+ to maintain. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
|
|
| IG444 |
C. elegans |
frEx113. Show Description
frEx113 [(pJL44) transposase + col-12p::DsRed]. Should be grown at 25C. Reference: Vallin E, et al. PLoS One. 2012;7(2):e30482.
|
|
| IJ1651 |
C. elegans |
mdt-15(yh44[mdt-15::degron::EmGFP]) III. Show Description
Degron and EmGFP tag inserted at the 3' end of the endogenous mdt-15 gene locus by CRISPR/Cas9 engineering. This strain can be used for auxin-inducible degradation (AID) of MDT-15 protein. Reference: Lee D, et al. PLoS Biol. 2019 Aug 13;17(8):e3000415. doi: 10.1371/journal.pbio.3000415. PMID: 31408455.
|
|
| LC141 |
C. elegans |
him-8(e1489) IV; cat-4(e3015) V. Show Description
Reduction in serotonin and dopamine, most apparent in young larva; bleach hypersensitivity and cuticle fragility in adult, but less than null mutants. Derived by outcrossing CB7107 six times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
|
|
| LC144 |
C. elegans |
agmo-1(e3016) III. Show Description
General chemical hypersensitivity (including bleach), fragile cuticle. Derived by outcrossing CB7014 five times to N2. [NOTE: the e3016 mutation is TGG>TGA but it affects codon W124, not W130.] Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
|
|
| LE3044 |
C elegans |
cdh-4(lq97) III; lqIs80 IV; lqIs58 V. Show Description
lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq97 is a hypomorphic allele of cdh-4. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.
|
|
| LE3078 |
C. elegans |
lqEx631. Show Description
lqEx631 [tiam-1::CFP + str-1::GFP]. GFP expression in AWB amphid neurons. CFP neural expression in the head and tail, the ventral cord commissural motorneurons, the mechanosensory neurons (ALMs, PLMs, AVM, PVM) and the CAN, PDE, and PVD neurons. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
|
|
| LE309 |
C. elegans |
lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)].
|
|
| LE3091 |
C. elegans |
juIs76 II; unc-6(e78) X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
|
|
| MT4917 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. Show Description
|
|
| MT5259 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. Show Description
|
|
| MT5260 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) III. Show Description
|
|
| NFB1445 |
C. elegans |
rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. Show Description
vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1719 |
C. elegans |
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Show Description
mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB1925 |
C. elegans |
vlcIs10 X. Show Description
vlcIs10 [srh-142::mCherry + elt-2::GFP] X. ADF-specific reporter. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| OE3001 |
C. elegans |
him-8(e1489) IV; dyf-4(m158) V. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males.
|
|
| OE3002 |
C. elegans |
him-8(e1489) IV; xbx-1(ok279) V. Show Description
Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
|
|
| OE3003 |
C. elegans |
xbx-4(ok635) IV. Show Description
No obvious phenotype.
|
|
| OE3005 |
C. elegans |
xbx-6(ok852) V. Show Description
No obvious phenotype.
|
|
| OE3010 |
C. elegans |
lin-15B&lin-15A(n765) X; ofEx4. Show Description
ofEx4 [trx-1::GFP + lin-15(+)]. Animals with the array are non-Muv. Animals which have lost the array are Muv. lin-15(n765) is temperature sensitive. GFP expression in ASJ neurons and to some extent in posterior-most intestinal cells.
|
|
| OE3035 |
C. elegans |
daf-19(sa232) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
| OE3059 |
C. elegans |
daf-19(rh1024) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
| OE3063 |
C. elegans |
daf-19(m86) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
| OH18614 |
C. elegans |
hlh-13(ot1388) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-13 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18615 |
C. elegans |
hlh-15(ot1389) X. Show Description
CRISPR/Cas9-engineered deletion removing entire hlh-15 locus. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18694 |
C. elegans |
col-105(syb6767[col-105::SL2::GFP::H2B]) him-8(e1489) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B at C-terminus using CRISPR/Cas9. The reporter is linked to him-8(e1489) in the background. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH18840 |
C. elegans |
hlh-32(ot1347) IV. Show Description
CRISPR/Cas9-engineered 1691 bp deletion removing entire hlh-32 locus; similar to syb6773 deletion. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| OH19054 |
C. elegans |
pha-1 (e2123) III; otEx8199. Show Description
otEx8199 [sshk-1p::GFP + pha-1(+)]. Maintain at 25C. 370 bp of promoter directly upstream of sshk-1 fused to GFP. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX3320 |
C. elegans |
nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX4430 |
C. elegans |
kcc-3(syb4430[kcc-3::SL2::TagRFP-T::H2B]) II. Show Description
Endogenous locus tagged with SL2::TagRFP-T::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX6078 |
C. elegans |
hlh-32(syb6078[hlh-32::GFP]) IV. Show Description
Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|
| PHX6112 |
C. elegans |
hlh-31(syb6112[hlh-31::GFP]) IV. Show Description
Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
|
|