LE3044 |
C elegans |
cdh-4(lq97) III; lqIs80 IV; lqIs58 V. Show Description
lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq97 is a hypomorphic allele of cdh-4. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.
|
|
LE3078 |
C. elegans |
lqEx631. Show Description
lqEx631 [tiam-1::CFP + str-1::GFP]. GFP expression in AWB amphid neurons. CFP neural expression in the head and tail, the ventral cord commissural motorneurons, the mechanosensory neurons (ALMs, PLMs, AVM, PVM) and the CAN, PDE, and PVD neurons. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
|
|
LE309 |
C. elegans |
lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)].
|
|
LE3091 |
C. elegans |
juIs76 II; unc-6(e78) X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
|
|
MT4917 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. Show Description
|
|
MT5259 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. Show Description
|
|
MT5260 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) III. Show Description
|
|
NFB1445 |
C. elegans |
rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. Show Description
vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1719 |
C. elegans |
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Show Description
mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1925 |
C. elegans |
vlcIs10 X. Show Description
vlcIs10 [srh-142::mCherry + elt-2::GFP] X. ADF-specific reporter. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
OE3001 |
C. elegans |
him-8(e1489) IV; dyf-4(m158) V. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males.
|
|
OE3002 |
C. elegans |
him-8(e1489) IV; xbx-1(ok279) V. Show Description
Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
|
|
OE3003 |
C. elegans |
xbx-4(ok635) IV. Show Description
No obvious phenotype.
|
|
OE3005 |
C. elegans |
xbx-6(ok852) V. Show Description
No obvious phenotype.
|
|
OE3010 |
C. elegans |
lin-15B&lin-15A(n765) X; ofEx4. Show Description
ofEx4 [trx-1::GFP + lin-15(+)]. Animals with the array are non-Muv. Animals which have lost the array are Muv. lin-15(n765) is temperature sensitive. GFP expression in ASJ neurons and to some extent in posterior-most intestinal cells.
|
|
OE3035 |
C. elegans |
daf-19(sa232) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
OE3059 |
C. elegans |
daf-19(rh1024) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
OE3063 |
C. elegans |
daf-19(m86) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
PJ1039 |
C. elegans |
unc-47(e307) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. Slight shrinking when poked.
|
|
SD1963 |
C. elegans |
unc-119(ed3) III; rde-1(ne300) V; gaEx234. Show Description
gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.
|
|
SD1965 |
C. elegans |
unc-119(ed3) III; rde-1(ne300) V; gaEx233. Show Description
gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.
|
|
SD1989 |
C. elegans |
rde-1(ne300) V; gaIs290. Show Description
gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
SV2002 |
C. elegans |
rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. Show Description
eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
|
|
WM118 |
C. elegans |
rde-1(ne300) V; neIs9 X. Show Description
neIs9 [myo-3::HA::RDE-1 + rol-6(su1006)]. Transgene rescues muscle RNAi defect. Rollers.
|
|
WM45 |
C. elegans |
rde-1(ne300) V. Show Description
RNAi deficient. Reference: Tabara H, et al. Cell 1999 Oct 15:99(2):123-32.
|
|
WM49 |
C. elegans |
rde-4(ne301) III. Show Description
RNAi deficient.
|
|
XE3004 |
C. elegans |
pha-1(e2123) III; wpEx505. Show Description
wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.
|
|
XE3088 |
C. elegans |
pha-1(e2123) III; wpEx517. Show Description
wpEx517 [srab-20p::Neptune2.5 + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Neptune2.5 expression in PHB neuron can be used to isolate PHB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
|
|