MT4917 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. Show Description
|
|
MT5259 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. Show Description
|
|
MT5260 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) III. Show Description
|
|
NFB1445 |
C. elegans |
rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. Show Description
vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1719 |
C. elegans |
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Show Description
mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1720 |
C. elegans |
tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1722 |
C. elegans |
lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB1925 |
C. elegans |
vlcIs10 X. Show Description
vlcIs10 [srh-142::mCherry + elt-2::GFP] X. ADF-specific reporter. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
OE3001 |
C. elegans |
him-8(e1489) IV; dyf-4(m158) V. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males.
|
|
OE3002 |
C. elegans |
him-8(e1489) IV; xbx-1(ok279) V. Show Description
Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
|
|
OE3003 |
C. elegans |
xbx-4(ok635) IV. Show Description
No obvious phenotype.
|
|
OE3005 |
C. elegans |
xbx-6(ok852) V. Show Description
No obvious phenotype.
|
|
OE3010 |
C. elegans |
lin-15B&lin-15A(n765) X; ofEx4. Show Description
ofEx4 [trx-1::GFP + lin-15(+)]. Animals with the array are non-Muv. Animals which have lost the array are Muv. lin-15(n765) is temperature sensitive. GFP expression in ASJ neurons and to some extent in posterior-most intestinal cells.
|
|
OE3035 |
C. elegans |
daf-19(sa232) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
OE3059 |
C. elegans |
daf-19(rh1024) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
OE3063 |
C. elegans |
daf-19(m86) II. Show Description
Daf-c. Dyf. Maintain at 15C.
|
|
PJ1039 |
C. elegans |
unc-47(e307) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. Slight shrinking when poked.
|
|
SD1963 |
C. elegans |
unc-119(ed3) III; rde-1(ne300) V; gaEx234. Show Description
gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.
|
|
SD1965 |
C. elegans |
unc-119(ed3) III; rde-1(ne300) V; gaEx233. Show Description
gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.
|
|
SD1989 |
C. elegans |
rde-1(ne300) V; gaIs290. Show Description
gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
SV2002 |
C. elegans N2 |
rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. Show Description
eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.
|
|
WM118 |
C. elegans |
rde-1(ne300) V; neIs9 X. Show Description
neIs9 [myo-3::HA::RDE-1 + rol-6(su1006)]. Transgene rescues muscle RNAi defect. Rollers.
|
|
WM45 |
C. elegans |
rde-1(ne300) V. Show Description
RNAi deficient. Reference: Tabara H, et al. Cell 1999 Oct 15:99(2):123-32.
|
|
WM49 |
C. elegans |
rde-4(ne301) III. Show Description
RNAi deficient.
|
|