More Fields
Strain Species Genotype
PE255 C. elegans feIs5 X. Show Description
feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.
PK125 C. elegans tra-2(e2531) II. Show Description
tra-2(e2531eg) Enhanced gain-of-function. Dominant allele that transforms XO animals into hermaphrodites. PK125 is composed of phenotypically WT hermaphrodites.
RG3239 C. elegans ZK858.7(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3263 C. elegans F15D3.6(ve763[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW3609 C. elegans unc-112(st581)/unc-39(e257) V. Show Description
Heterozgyotes are WT and segregate WT, Unc and Pats. Maintain by picking WT and checking for correct segregation of progeny.
SP1696 C. elegans him-10(e1511) ncl-1(e1865) unc-36(e251) III. Show Description
Unc strain. Throws males (ts).
SP1697 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp84 (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplications are DpyUncNcl. Maintain by picking WT. Males containing mnDp84 are not fertile.
SP1707 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp86 [dpy-1(+) him-10(+) ncl-1(+) unc-36(+)] (III;f). Show Description
Animals with mnDp86 are WT. Animals which have lost mnDp86 are DpyUnc and Ncl.
SP1781 C. elegans ncl-1(e1865) unc-36(e251) III; mnDp89 [ncl-1(+) unc-36(+) unc-3(+)] (III;f). Show Description
Animals with mnDp89 are WT. Animals which have lost mnDp89 are Unc and Ncl. mnDp89 not transmitted by males. mnDp89 formed by fusing mnDp14 and mnDp84.
SP1784 C. elegans dpy-1(e1) ncl-1(e1865) unc-36(e251) III; him-8(e1489) IV; mnDp90 [dpy-1(+) ncl-1(+) unc-36(+) unc-93(+)] (III;f). Show Description
Animals with mnDp90 are WT. Animals which have lost mnDp90 are DpyUnc and Ncl. Throws males. Males containing mnDp90 are fertile. mnDp90 was derived from mnDp86.
SP2101 C. elegans ncl-1(e1865) unc-36(e251) III; osm-6(p811) V; mnIs17. Show Description
mnIs17 [osm-6::GFP + unc-36(+)].
SP2628 C. elegans unc-36(e251) III; mnIs61. Show Description
mnIs61 [dpy-7p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2642 C. elegans unc-36(e251) III; mnIs63. Show Description
mnIs63 [dpy-7p::unc-52(e669)(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2668 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx142. Show Description
mnEx142 [smu-2::GFP + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP2678 C. elegans unc-36(e251) III; mnIs64. Show Description
mnIs64 [myo-3p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
SP2686 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx151. Show Description
mnEx151 [smu-1::GFP + smu-2::3xHA + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP2688 C. elegans smu-1(mn415) I; unc-36(e251) III; mnEx156. Show Description
mnEx156 [smu-2::GFP + smu-1::3xHA + unc-36(+)( R1p16)]. Maintain by picking non-Unc.
SP2693 C. elegans smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnIs66. Show Description
mnIs66 [smu-2::HA + unc-36(+)]. Strain should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
SP462 C. elegans dpy-1(e1) unc-36(e251) III; mnDp37[unc-32(e189)] (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc-36.
SV1619 C. elegans dhc-1(he250[mCherry::dhc-1]) I. Show Description
This strain carries endogenously tagged dynein heavy chain (mCherry::dhc-1). Reference: Schmidt et al., J Cell Biol. 2017 Sep 4; 216(9): 2777–2793. doi: 10.1083/jcb.201607038
SV2061 C. elegans he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II; e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Show Description
he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.
TBD307 C.elegans dhc-1(he255[epdz::mCherry::dhc-1]) I; utdSi51 II. Show Description
utdSi51[mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3’UTR] II. Maintain at 23C and protect from light. Strain is sickly, seems to grow best and lay more eggs at 23C. Upon stimulation with 488nm light, the LOV-ePDZ optogenetic system will recruit mitochondria to the dynein heavy chain in the worm embryo. Embryonic cell divisions can be stopped by if mitochondrial recruitment is stimulated in early development. Room light can also induce mitochondria re-localization and cause infertility; store this strain in the dark. Reference: Fan X, et al. G3 (accepted).
TY3936 C. elegans dpy-21(e428) V. Show Description
Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.
VT765 C. elegans unc-36(e251) III; maIs103. Show Description
maIs103 [rnr::GFP + unc-36(+)].
VT774 C. elegans unc-36(e251) III; maIs103. Show Description
maIs103[rnr::GFP + unc-36(+)]. Non-Unc. nrn::GFP is expressed in S phase cells.
XA1433 C. elegans unc-36(e251) III; qaIs1400. Show Description
qaIs1400 [hsp16-2::ptx + unc-36(+)]. ptx is the gene for pertussis toxin S1 subunit from Bordetella pertussis.