More Fields
Strain Species Genotype
GR2107 C. elegans daf-2(e1370) III; mgEx371. Show Description
mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
HT1881 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1882 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs13. Show Description
lpIs13 [daf-16b::CFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1883 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1890 C. elegans daf-16(mgDf50) I; daf-2(e1370) III. Show Description
Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
LP852 C. elegans daf-2(e1370) III; lea-1(cp423[myo-2p::GFP::myo-2UTR]) V. Show Description
Maintain at 15C. Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP860 C. elegans daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP861 C. elegans daf-2(e1370) III; lea-1(cp430[lea-1::mYPET::3x FLAG]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mYPET. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
MAH14 C. elegans daf-2(e1370) III; adIs2122. Show Description
adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Maintain at 15C. ~30% animals form dauers at 20C. Not all animals will roll, but all should be GFP+. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.
MQ513 C. elegans daf-2(e1370) clk-1(e2519) III. Show Description
Daf-c at 25C. Slower growing than clk-1(e2519).
MQ876 C. elegans daf-2(e1370) III; isp-1(qm150) IV. Show Description
Slow development rate. Dauer constitutive at 25C. Grow at 15C.
MQD2490 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) III. Show Description
Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2491 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in somatic tissues. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2492 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; hqSi8 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3’UTR+Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2493 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; hqSi9 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2494 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; ieSi61 II; daf-2(e1370) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2495 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2498 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the germ line. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2499 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; hqSi10 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2500 C. elegans daf-16(hq389[daf-16::gfp::degron]) I; hqSi11 II; daf-2(e1370) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD774 C. elegans daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About two mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MQD812 C. elegans daf-16(mu86) I; daf-2(e1370) III; hqIs180. Show Description
hqIs180 [sdhb-1p::mtLS::cpYFP + rol-6(su1006)]. Rollers. About three mitoflash events per anterior pharynx per 200 seconds on adult day 3 when cultured on standard NGM plates at 20 ºC. In hqIs180, mtLS is a mitochondrial localization sequence from SDHB-1 and cpYFP is circularly permuted yellow fluorescent protein, a superoxide sensor (Wang W. et al., Cell, 2008). The cpYFP signal is detected in most or all tissues, but most strongly in the pharyngeal muscles. Reference: Shen E-Z, et al. Nature. 2014 Feb 12. doi: 10.1038/nature13012.
MR905 C. elegans daf-2(e1370) aakb-2(rr88) III. Show Description
Daf-C at 25C.
MT3363 C. elegans daf-2(e1370) dpy-17(e164) III. Show Description
Dpy. Daf-C. Maintain at 15C.
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted
OH14888 C. elegans daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH15845 C. elegans daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH16508 C. elegans daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
PS8441 C. elegans daf-2 (e1370) III; glo-1(sy1306) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
SD1625 C. elegans egl-27(we3) II; daf-2(e1370) III. Show Description
Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
SD1743 C. elegans egl-27(we3) II; daf-2(e1370) III; muIs84. Show Description
muIs84 [sod-3p::GFP + rol-6(su1006)]. Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. GFP should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
SD1776 C. elegans daf-2(e1370) III; ccIs4251; stIs10161. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or lower. Dauer formation at 25C. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
SD1777 C. elegans daf-2(e1370) III; elt-3(vp1) X; stIs10161. Show Description
stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or lower. Dauer formation at 25C. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
SD1778 C. elegans daf-16(mu86) I; daf-2(e1370) III; stIs10161. Show Description
stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
TM127 C. elegans daf-2(e1370) III; sod-3(sj134) X. Show Description
High frequency of dauer formation under hyperoxia (90% oxygen) at 20C. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.
TM151 C. elegans sod-2(sj173) I; daf-2(e1370) III; sod-3(sj134) X. Show Description
Hypersensitive to Paraquat. Growth arrest under hyperoxia (90% oxygen) at any larval stage. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.
TM185 C. elegans daf-2(e1370) mev-1(kn1) III. Show Description
Daf-c. Maintain at 15C. Sensitive to hyperoxia and paraquot, comparable to mev-1(kn1) alone. High mutation rate. Extended lifespan measured after mid-adult stage is similar to daf-2(e1370) alone. High mortality rate in early adults. Reference: Honda Y, Tanaka M, Honda S. Exp Gerontol. 2008 Jun;43(6):520-9.
XE1024 C. elegans daf-2(e1370) III; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Higher axon regeneration in aged animals. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73.
XE1593 C. elegans daf-16(mu86) I; wpSi14 II; daf-2(e1370) III. Show Description
wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73. doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228
ZM1157 C. elegans daf-2(e1370) III; juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM4864 C. elegans daf-2(e1370) III; oxIs22. Show Description
oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Temperature-sensitive Daf-c. GFP punctae are relatively normal in dauers. Maintain at 15C. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
ZM8561 C. elegans daf-2(m596) III; hpEx2906. Show Description
hpEx2906 [myo-2p::RFP + rgef-1p::daf-2]. Transgenic worms dauer easily. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8562 C. elegans daf-2(m596) III; hpEx3369. Show Description
hpEx3369 [myo-2p::RFP + ges-1p(short)::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM8874 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3371. Show Description
hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM8988 C. elegans daf-2(m596) III; hpEx2908. Show Description
hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9028 C. elegans daf-2(m596) III; hpEx2905. Show Description
hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZM9441 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3370. Show Description
hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9442 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3373. Show Description
hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.