NL1608 |
C. elegans |
dpy-20(e1282) IV; pkIs588. Show Description
pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
NL1609 |
C. elegans |
dpy-20(e1282) IV; pkIs589. Show Description
pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.
|
|
NL1610 |
C. elegans |
dpy-20(e1282) IV; pkIs590. Show Description
pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.
|
|
NL1611 |
C. elegans |
dpy-20(e1282) IV; pkIs591. Show Description
pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.
|
|
NL2328 |
C. elegans |
dpy-20(e1282) IV; pkIs1269. Show Description
pkIs1269 [gpa-13XS(+) + dpy-20(+)].
|
|
NL2334 |
C. elegans |
dpy-20(e1282) IV; pkIs1273. Show Description
pkIs1273 [gpa-16::GFP + dpy-20(+)].
|
|
NL2336 |
C. elegans |
dpy-20(e1282) IV; pkIs1275. Show Description
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
|
|
NL3161 |
C. elegans |
pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
|
|
NL4258 |
C. elegans |
pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
|
|
NW906 |
C. elegans |
pag-1(ls2) III; dpy-20(e1282) IV; seu-2(ev523) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
|
|
NW988 |
C. elegans |
pag-1(ls2) III; dpy-20(e1282) IV; seu-3(ev555) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
|
|
PD4251 |
C. elegans |
ccIs4251 I; dpy-20(e1282) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).
|
|
PD4443 |
C. elegans |
ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.
|
|
PD4655 |
C. elegans |
dpy-20(e1282) IV; ccIs4655. Show Description
ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter.
|
|
PD4666 |
C. elegans |
ayIs6 X. Show Description
ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
|
|
PD4667 |
C. elegans |
ayIs7 IV. Show Description
ayIs7 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.
|
|
PS1595 |
C. elegans |
lfe-2(sy326) I; lin-3(n1058) dpy-20(e1282) IV. Show Description
sy326 suppresses the sterility of n1058. Dpy. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS1631 |
C. elegans |
itr-1(sy290) dpy-20(e1282) IV. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS1681 |
C. elegans |
dpy-20(e1282) IV; syIs17. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)]. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS1702 |
C. elegans |
dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS1922 |
C. elegans |
dpy-20(e1282) syIs24 IV. Show Description
syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2105 |
C. elegans |
dpy-20(e1282) IV; syIs13. Show Description
syIs13 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2109 |
C. elegans |
dpy-20(e1282) IV; syIs25 X. Show Description
syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2399 |
C. elegans |
dpy-20(e1282) IV; syIs30 X. Show Description
syIs30 [(pJMG2QL) gpa-2(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-2. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2442 |
C. elegans |
dpy-20(e1282) IV; syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Non-Dpy. Upon heat shock, two intense spots of nuclear fluorescence due to lacO in the chromosome, and a diffuse nuclear fluorescence due to nuclear-localized GFP-lacI. Array derived from Fire Lab vector pPD49-78 and dpy-20 rescuing construct pMH86. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2444 |
C. elegans |
dpy-20(e1282) IV; syIs36. Show Description
syIs36 [(pLB2) egl-30(+) + pBS + (pMH86) dpy-20(+)]. Integrated version of syEx126 (egl-30 over-expressing line). Easily reverted. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2467 |
C. elegans |
dpy-20(e1282) IV; syEx178. Show Description
syEx178 [hsp16.1::egl-5 + (pMH86) dpy-20(+) + pBS]. Heat-shock egl-5. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2746 |
C. elegans |
dpy-20(e1282) IV; syEx234. Show Description
syEx234 [let-23::GFP + pBS + (pMH86) dpy-20(+)]. Non-Dpys bear the transgene and express GFP in multiple cells including the pn.ps and uv1. Maintain by picking Non-Dpy. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2767 |
C. elegans |
hmg-1.2(sy549) III; dpy-20(e1282) IV; syIs20 him-5(e1490) V. Show Description
syIs20 [gpa-1::lacZ + dpy-20(+)] V. Him. p-Vul. Abnormal secondary vulva lineage defect in 10% of animals. Reduced brood size as well as other pleiotropic defects. Males have ray defect (cannot mate) and SPD sheath to neuron transformation, which can be visualized by lacZ staining in syIs20 [gpa-1::lacZ] background: 1 cell per spicule stains in WT (the SPD neuron) whereas in hmg-1.2(sy549), 2 cells per spicule stain. sy549 previously called son-1. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS2958 |
C. elegans |
syIs46 II; ncl-1(e1865) III; dpy-20(e1282) IV; him-5(e1490) V. Show Description
syIs46 [dpy-30::S65T::lacI + hsp-16p::GFP::lacI + dpy-20(+)] II. Animals are Ncl, Him and Non-Dpy. Heat shock results in diffuse nuclear GFP expression from Fire Lab vector pPD49.78::LacI in most cells. Also see some consitutive GFP expression in embryos from dpy-30 promoter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3003 |
C. elegans |
dpy-20(e1282) ark-1(sy247) IV. Show Description
Dpy. WT vulva at 20C. At 25C, occasional animals with hyperinduced vulva are observed. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3239 |
C. elegans |
dpy-20(e1282) syIs49 IV. Show Description
syIs49 [zmp-1::GFP + (pMH86) dpy-20(+)] IV. Non-Dpy. Expresses GFP in anchor cell at L3 stage. VulA at late L4, and VulE soon thereafter. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS3351 |
C. elegans |
dpy-20(e1282) syIs17 IV. Show Description
syIs17 [pJMGoQLHS + (pMH86) dpy-20(+)] IV. Non-Dpy animals which at all stages progressively exhibit Go(gf) phenotype after heat shock treatment (standard treatment is 33C water bath for 30 minutes). Animals cease feeding, foraging, locomotion, ovulating and egg laying. Gravid adults eventually bag. "Suicides" are common. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS4263 |
C. elegans |
egl-30(md186) I; dpy-20(e1282) IV; syIs105. Show Description
syIs105 [egl-30::GFP + dpy-20(+)]. Translational fusion contains all of the presumptive 5'-transcriptional regulatory sequences, introns, and presumptive 3 regulatory sequences for egl-30, in addition to the coding sequences for GFP just 5' of the egl-30 initiating methionine. syIs105 was found to partially rescue egl-30(md186) with respect to egg laying, movement, pharyngeal pumping, and response to neurotransmitters in egg-laying assays.
|
|
PS468 |
C. elegans |
let-60(sy100) dpy-20(e1282)/let-60(n1046) unc-22(s7) IV; him-5(e1490) V. Show Description
Heterozygotes are weak Muv and segregate weak Muv, Muv Twitchers, and Dpy Vuls whose progeny are larval lethal. sy100 is a dominant negative allele of let-60. n1046 is a gain-of-function allele of let-60. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS524 |
C. elegans |
let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS99 |
C. elegans |
dpy-20(e1362) IV. Show Description
Severe Dpy. Cold sensitive: grow at 20C. Can be used for microinjection because rescued animals are easier to pick out than dpy-20(e1282) rescued animals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
RV120 |
C. elegans |
spe-44(ok1400) dpy-20(e1282)/let-92(s677) unc-22(s7) IV. Show Description
Pick wild-type to maintain.
|
|
SM1052 |
C. elegans |
zen-4(px47) dpy-20(e1282)/bli-6(sc16) unc-24(e138) Show Description
Heterozygotes are WT and segregate WT, Bli Uncs, and dead embryos and L1s (with Pun phenotype).
|
|
SP1471 |
C. elegans |
unc-24(e138) dpy-20(e1282) IV. Show Description
|
|
SS360 |
C. elegans |
mes-6(bn66) dpy-20(e1282) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc (n754 is dominant Unc and recessive lethal). Hets throw Dpys which give only sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 1% maternal effect embryonic lethality.
|
|
TH11 |
C. elegans |
unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
|
|
TU2589 |
C. elegans |
dpy-20(e1282) IV; uIs25 X. Show Description
uIs25 [mec-18::GFP + dpy-20(+)].
|
|
TY5434 |
C. elegans |
syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.
|
|
VT825 |
C. elegans |
dpy-20(e1282) IV; maIs113. Show Description
maIs113 [cki-1::GFP + dpy-20(+)]. Non-Dpy. cki-1::GFP is expressed in all arresting cells that have exited cell cycle.
|
|
WU48 |
C. elegans |
lin-45(n2018) dpy-20(e1282) IV. Show Description
Intermediate severity of lin-45 raf allele: at 20C, 76% larval lethal and 24% display an abnormal vulva (either Egl, no discernable vulva, or PVul). Medium Dpy. Received new stock 11/2002.
|
|
WU57 |
C. elegans |
lin-45(n2510) unc-24(e138)/unc-5(e53) dpy-20(e1282) IV. Show Description
Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.
|
|