Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.

F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28H8.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1483 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30B5.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1416 homozygotes (sterile adult, explodes at vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk434 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk438 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A8.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1515 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C12.1a. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk522 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.1, T12D8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk445 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk511 homozygotes (late larval arrest or sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48E8.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1539 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCTGCGTATCACTGTCGC. External right primer: CAGAGTTTTGTCTCGAGGGC. Internal left primer: CTCTTGTTCTCCTCATGCCC. Internal right primer: CTCGGGAACAAAAATGGAAA. Internal WT amplicon: 2209 bp. Deletion size: 621 bp. Deletion left flank: TTGGCGTTGGGTGTGGAGCGCACACGCAAC. Deletion right flank: AAGAAGAAACTCATCGAGCCAATTCTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk515 homozygotes (late larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R166.3. Homozygous marginally-viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk541 homozygotes (mostly sterile; some animals bear a few progeny, but a population may be difficult to maintain). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAGGAGTACACGCCGGATAA. External right primer: AGACCATTTTGCAGGATTGC. Internal left primer: AAGTGCTGACCGAAGAGCAT. Internal right primer: TGGGATTTGAAACGAGAACC. Internal WT amplicon: 1529 bp. Deletion size: 388 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19E10.1a. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk44 homozygotes (sterile). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R12B2.4. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok263 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07F8.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk530 homozygotes (sterile adult, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCACTTGGCTGATTCGTCTG. External right primer: TGTGCAAATGGATCAGGTGT. Internal left primer: CCTTCAACCGTTGCTTCATT. Internal right primer: ACAGAACGATCGGGAAGTTG. Internal WT amplicon: 1857 bp. Deletion size: 974 bp. Deletion left flank: GGTTCTGCAGCAGCCGAACTTGATTCCCCT. Deletion right flank: TTACTGAGCAAACGCTTTAGTGTTAGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A11.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1590 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACTATCCCCACAGAAGCC. External right primer: ATACCTACGCCCGCCTACTT. Internal left primer: GCGCGTAAACTTCTTTCCAG. Internal right primer: TCTCCACATTTTCCACCACA. Internal WT amplicon: 3007 bp. Deletion size: 1099 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07E3.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1629 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATGGAAACAACAGAAGGGG. External right primer: GAGCCATTTTGAAGTTTGGC. Internal left primer: CGGCGTTTCTTCTTGTCTTC. Internal right primer: AAAATCAGGTTTTCATGGCG. Internal WT amplicon: 3006 bp. Deletion size: 809 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37C12.13. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1635 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57A10A.15. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1548 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Outer Left Sequence: ACCGTAGCCCTTTCCTCATC. Outer Right Sequence: CGCATTTCCCATCTGTCTTT. Inner Left Sequence: ACCTCTTCGTTTTGGGGATT. Inner Right Sequence: CCATCCGGCCTATTTAATCA. Inner Primer WT PCR Product: 3241. Deletion size: 2149 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13A5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAGCCCGAAATTTTTGTAA. External right primer: CCGTAATATGTGTTGCAGCG. Internal left primer: CGTGTCTCTAGCTTCCCTGC. Internal right primer: ATCTACGTGCATTCGCACTG. Internal WT amplicon: 2867 bp. Deletion size: 1546 bp. Deletion left flank: TGCTTCTTCAAATGCTTCTCGAAGGCCAAC. Deletion right flank: ATTGTGGTCAACGATGCGCTTATTATCATT. Insertion Sequence: GTGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36E8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1714 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGAGGATCCACCCATCATC. External right primer: GAAGCTTGAAGAAGAGGCGA. Internal left primer: TGGAGTCATGAACTTGCTGC. Internal right primer: GAAACTTTCGAGCAATGGGA. Internal WT amplicon: 3294 bp. Deletion size: 833 bp. Deletion left flank: ACATTCTAGAAATGTGTCAAAAAGCTTCTC. Deletion right flank: TTTCAAAATGCTCATTTTGAACTTTTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H20J04.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1739 homozygotes (slow-growing, sickly, mostly sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCCGGAGCATGAAATTCTTA. External right primer: AATGGAGCTCGAAAATGTGG. Internal left primer: TCCAACGCACAATTGAAAAA. Internal right primer: TCCAGCAAAATATGGTGCAA. Internal WT amplicon: 2146 bp. Deletion size: 853 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47G2.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1740 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTGGAGTGTGAAGGCCACTT. External right primer: AAAGAACCGCAAAATCGAGA. Internal left primer: AATGCACACTCTGCGTTTTG. Internal right primer: TTCTGGTTGAAAATGAGGGG. Internal WT amplicon: 3279 bp. Deletion size: 1176 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk582 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATGATAAGACGTCCTTGCCG. External right primer: TGCCTCTGCATTGTTCTCAC. Internal left primer: TGTTTGCACTGTTCGACGTT. Internal right primer: GGCGGATTGATTCATATGCT. Internal WT amplicon: 2222 bp. Deletion size: 1146 bp. Deletion left flank: GCGGTTTTTAAAATAACGTGAATATTGCTT. Deletion right flank: GACAAACACTGAGCGAGAAAACGAATCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1067.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1789 homozygotes (variable arrest, larval through sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAACAGAAGTTGTCGCA. External right primer: GTCAACAAACCAAATGCGTG. Internal left primer: AGAATTCAGGGAAGGGGATG. Internal right primer: CTCCGGTTTCCGAGTATGAA. Internal WT amplicon: 2113 bp. Deletion size: 292 bp. Deletion left flank: AAAAGTAGTATTTAAAAAAGAAATTTACCT. Deletion right flank: GCGTTCGAAACAACTCCTTGAATCGGAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22B5.1, F22B5.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1819 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATGAACGCTTTTGCAGAC. External right primer: TGAGAACGGTTGTGCTCTTG. Internal left primer: TACCAATTGGACGAGGAAGC. Internal right primer: TTCTTGATGTCCGTGCTGAG. Internal WT amplicon: 2108 bp. Deletion size: 757 bp. Deletion left flank: TGCTTTAATTTGGGTGGTAGATTCGTCAGA. Deletion right flank: AACGGTAAGACCAAGGAAGACAGTGACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F43E2.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1800 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCGTATCAAGTCGCTCGTT. External right primer: AAACCTCAGCGGTCAGAAGA. Internal left primer: ATTGGATGGATCATCGGGTA. Internal right primer: GCATCTTCCTCGACTTGTCC. Internal WT amplicon: 2135 bp. Deletion size: 1182 bp. Deletion left flank: CTCGAAAAATACATTATAGCGAAGATTGGA. Deletion right flank: ATTTCTCCTGTAAAACTGAATTTCAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk612 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTGCGCAATATCCAGAGA. External right primer: TCATCATTGACTTCCCACCA. Internal left primer: CCGAAAGAGAGTGAAGACGG. Internal right primer: TAAGCTGATCGTTGACCGTG. Internal WT amplicon: 1778 bp. Deletion size: 571 bp. Deletion left flank: TTCCTCTCCCGCAATTTGAATTTTTTCTCT. Deletion right flank: CCATCAAAATGGAGATTCCCATGCATCCGT. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R144.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1869 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCCAGATGAGGAAACAACA. External right primer: CTCAGGTGACACCAAAACGA. Internal left primer: TCGAAGATCTTGGCAGAGGT. Internal right primer: ACATACCCCAACTCAGTGGC. Internal WT amplicon: 3130 bp. Deletion size: 1991 bp. Deletion left flank: ATCGAGAAGGCTGTGTATGTGTGTCAACTT. Deletion right flank: AACAGAACGAGCTCTTCGTGAACTCCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25F2.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1876 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGAGTATCGCGCATCATA. External right primer: TCCATTGCATCCAAACGTAA. Internal left primer: CCGAATGGCGAGAGATGTAT. Internal right primer: TTTGTTGGCAATGAGTGCAT. Internal WT amplicon: 2539 bp. Deletion size: 1864 bp. Deletion left flank: GACGGATCATGTGGTCATTGCTGAGAAGTT. Deletion right flank: GAATCTGCAGAAGCAGAAGCAACTGCTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1891 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 744 bp. Deletion left flank: TCAGACGACACAACTCTCGATCAAATGGTA. Deletion right flank: AGAAGGAAGGTACTGTGGAAAATTTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK20.3, ZK20.4. Homozygous lethal/sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1910 homozygotes (late larval arrest or sterile adult with no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGACTTGCATCGTCTCCAA. External right primer: AGAGCCTTCTCAACTGCGAC. Internal left primer: TGACAGGATTCTGGCCTTTT. Internal right primer: AGAAGATTTTTATGGGCGGC. Internal WT amplicon: 2172 bp. Deletion size: 1030 bp. Deletion left flank: AAATTTCTCACTTCGTAGCATCCAAATCTG. Deletion right flank: AATCTGGTTCTTGGTCAGCAGCATCATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1911 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 918 bp. Deletion left flank: ATGAAGTACGTACACAATTCTCAAAGTATT. Deletion right flank: AATTAATTGCAACAATGTATCAAACTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D5.8, F54D5.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1925 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CTCTGGAAAGTTCCGCACTC. External right primer: TTTGGAGGGTGAGCTCAAGT. Internal left primer: TTCCATTTCTCCGTGTTTCC. Internal right primer: AGGTGATTGTTGCGGTTTTT. Internal WT amplicon: 2104 bp. Deletion size: 1109 bp. Deletion left flank: AGATGAAGATTACAAGAAAAGTTATGACGG. Deletion right flank: TTAATATTTAAGGCTGGTGTAGTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24H10.6, T24H10.3. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1931 homozygotes (Sma, Unc, Gro with tail and vulval defects). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGGCGATTATGGAAGAGGAG. External right primer: ATTGCGATGAGAAAGCTCGT. Internal left primer: ATTCTCGCAAAGGCGACTAA. Internal right primer: CAAGCGTAAGGCTGAGAAGG. Internal WT amplicon: 2301 bp. Deletion size: 1608 bp. Deletion left flank: AGTTAGTAGGAACCAAGTTTGGCGAATACG. Deletion right flank: AAAACTTATAAATAAAGTGACAGATTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12D12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1930 homozygotes (sterile Unc with withered tail, often grotty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCAATCAAAGGATTCGAGG. External right primer: ATGTCCTGGCCTTCCTTTTT. Internal left primer: GAACCCCTCAAGATCGCATA. Internal right primer: GGCTCCTTTGGCTCTTTCTT. Internal WT amplicon: 3358 bp. Deletion size: 1788 bp. Deletion left flank: TAGTGACGCTGGAGAAAGTTTTTATCCAGT. Deletion right flank: AGCTCCATGGTACAAGAACTTCCGCGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M106.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1929 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTTGTTCTTTTTGCACGCTG. External right primer: AGGGAACTGATGTTCCGATG. Internal left primer: CGGGAGCCAATTTACAGAAA. Internal right primer: GAACGAAAATGGTCCAGGAA. Internal WT amplicon: 2129 bp. Deletion size: 1084 bp. Deletion left flank: AAAACAAAAATTTGAAGAACTCTGGCGAAA. Deletion right flank: CTGCAGACAAACAAAAGCTCCAGCGGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12D12.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1999 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTTGCCAGTGTCAATCAGC. External right primer: TCGCTCTCCACTTCTCCAGT. Internal left primer: CCCCAGAACCACAAGACACT. Internal right primer: TCGATGCTTGATTTGCTGAC. Internal WT amplicon: 3383 bp. Deletion size: 1321 bp. Deletion left flank: GTAACCAACAATCATACGACGAACAGCGAA. Deletion right flank: ATTCGATATATTTGAGGCCTGAAACTCACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13D12.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1875 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGATGTGGGGGTTTTAGGA. External right primer: ATCGCGTCGCTCACTAGAAT. Internal left primer: ATCGGGGAGAGAAAGAGAGC. Internal right primer: GGGGCACTATTGCATCATCT. Internal WT amplicon: 2980 bp. Deletion size: 1978 bp. Deletion left flank: GTAGAATACGATCGGGGAGAGAAAGAGAGC. Deletion right flank: ACGAGACACCCGCACGTTTCCCTCGCGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G7.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk685 homozygotes (sterile, with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATCAGCAGTGAA. External right primer: ATACCGGCAGCAGCTAGAAA. Internal left primer: TTTGACAACAATCCAATCGC. Internal right primer: AGCTTGTCGGCTCAACGTAT. Internal WT amplicon: 2352 bp. Deletion size: 871 bp. Deletion left flank: ACAAACCAACCGGACTCAGACATTTTTCCA. Deletion right flank: TGGAAACCACAATTTTCAGACCGTAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06A4.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1849 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGTCTTTTGGATGACACCG. External right primer: CCGCCAAATTACCTACCAAA. Internal left primer: TACTGTATCCGGAGCCATCC. Internal right primer: TGGGTGGTTGACCAATTTCT. Internal WT amplicon: 3238 bp. Deletion size: 1398 bp. Deletion left flank: CCATCCACCAGTAGAAAAAACCAATCAGAT. Deletion right flank: GATCAGAATAATACAATCCTAACTGTTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M142.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk709 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTTCCCCTCTTCTATTGGC. External right primer: CGACACGCAACACCAATTAC. Internal left primer: AATCCACCGTAGTCACCGAG. Internal right primer: TCAGAGCATGTTTCCCAGTG. Internal WT amplicon: 2427 bp. Deletion size: 1019 bp. Deletion left flank: TAAATTTTTGTAGTTTTTTAGGGATTTTTT. Deletion right flank: TCACTTGTGGAGATGGTCGCCGCATCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807