More Fields
Strain Species Genotype
RG5060 C. elegans ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG93 C. elegans lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).
SA25 C. elegans daz-1(tj3)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT (GFP+) and segregate WT (GFP+), Dpys (GFP+) and Steriles.
SA29 C. elegans kel-1(pe201)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and L2 larva. kel-1(pe201) homozygotes arrest development at early L2. pe201 deletes a 3.6 kb region including most of the kel-1 ORFs.
SA4 C. elegans cdl-1(w37)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs (homozygous cdl-1(w37)), and DpyUnc. w37 carries a 4.7kb deletion that removed the entire cdl-1 ORF and part of the neighboring ORF (T19E10.1), with a small insetion of about 60 bp.
SL740 C. elegans dpy-2(e8) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.
SL940 C. elegans wee-1.3(q89eb94) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay oocytes (lay viable embryos if mated to WT males). Strain has a Him phenotype. 3.4% males. Mutant males have abnormal sperm. Class 1 suppressor.
SL978 C. elegans wee-1.3(q89eb60) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay inviable embryos (lay viable embyros if mated to WT males). Strain has a Him phenotype. 0.4% males. Mutant males are fertile. Class 2 suppressor.
SP127 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, Unc-4 and paralysed DpyUnc (mnC1). Maintain by picking WT.
SP140 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-28(mn28) II. Show Description
Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT.
SP142 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-30(mn30) unc-4(e120) II. Show Description
Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males.
SP143 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/let-31(mn31) unc-4(e120) II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT.
SP144 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/unc-4(e120) let-32(mn32) II. Show Description
Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT.
SP152 C. elegans him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/zyg-11(mn40) unc-4(e120) II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT.
SP158 C. elegans spe-1(mn47) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT.
SP174 C. elegans sqv-8(mn63) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT. mn63 pka spe-2. See also WBPaper00003405 and #3406.
SP198 C. elegans let-262(mn87) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Het are WT and segregate WT, paralysed DpyUnc, and dead eggs. Maintain by picking WT.
SP199 C. elegans let-236(mn88) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregates WT, paralysed DpyUnc, and larvae which are arrested. Pick L1-L2 Unc-4's to check for larval lethal phenotype. Maintain strain by picking WT
SP201 C. elegans unc-4(e120) let-242(mn90)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Pick WT to maintain. Hets segregate WT, DpyUncs, and lethals (early larval arrest).
SP204 C. elegans let-239(mn93) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUncs, and dead eggs. Pick WT to maintain.
SP206 C. elegans unc-4(e120) let-251(mn95)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP208 C. elegans unc-4(e120) let-244(mn97)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, dead eggs and paralysed DpyUnc. Maintain by picking WT.
SP210 C. elegans unc-4(e120) let-246(mn99)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals which are Unc. Maintain by picking WT.
SP211 C. elegans let-252(mn100) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP212 C. elegans let-253(mn181) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, DpyUnc and UncLets. Lethal early larval. Maintain by picking WT.
SP216 C. elegans unc-4(e120) let-245(mn185)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP281 C. elegans unc-4(e120) let-268(mn189)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, and Lets.
SP286 C. elegans unc-4(e120) let-266(mn194)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and lets.
SP306 C. elegans mnC1 [dpy-10(e128) unc-52(e444)/unc-4(e120) unc-52(e444)] II; mnDp34 (II;f). Show Description
Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).
SP307 C. elegans mnC1 [dpy-10(e128) unc-52(e444)/unc-4(e120) unc-52(e444)] II; mnDp35 (II;f). Show Description
Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).
SP308 C. elegans mnC1 [dpy-10(e128) unc-52(e444)/unc-4(e120) unc-52(e444)] II; mnDp36 (II;f). Show Description
Maintain by picking WT. Segregates WT (hets with the duplication), paralyzed Unc (hets without the duplication or unc-4 unc-52 homozygotes without the duplication), DpyUnc (mnC1 dpy-10 unc-52 homozygotes without the duplication), Dpy (mnC1 dpy-10 unc-52 homozygotes with the duplication), and Unc-4 (unc-4 unc-52 with the duplication).
SP354 C. elegans unc-4(e120) mnDf71/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP355 C. elegans unc-4(e120) let-25(mn25)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, and early larval Unc-4. Maintain by picking WT.
SP364 C. elegans let-19(mn19) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, and early larval Unc-4. Maintain by picking WT.
SP365 C. elegans unc-4(e120) mix-1(mn29)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralyzed DpyUnc and late larval arrest (unc-4 mix-1 homozygotes). Maintain by picking WT. mix-1 previously known as let-29(mn29). See also WBPaper00002999.
SP371 C. elegans unc-4(e120) let-26(mn26)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and early larval Unc-4. Maintain by picking WT.
SP373 C. elegans unc-4(e120) let-27(mn27)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and early larval Unc-4. Maintain by picking WT.
SP377 C. elegans let-22(mn22) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and early larval lethals.
SP378 C. elegans let-23(mn23) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and early larval Unc-4. Maintain by picking WT.
SP379 C. elegans let-24(mn24) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, DpyUnc and early larval Unc-4. Maintain by picking WT.
SP424 C. elegans mnDf12/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs (some early larval lethals). Maintain by picking WT.
SP425 C. elegans mnDf14/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, DpyUnc and kinker Uncs which arrest as L1s. Maintain by picking WT.
SP426 C. elegans mnDf16/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP427 C. elegans mnDf22/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Manintain by picking WT.
SP428 C. elegans mnDf24/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP429 C. elegans mnDf25/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP430 C. elegans mnDf26/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and dead eggs. Maintain by picking WT.
SP432 C. elegans unc-4(e120) ooc-3(mn241)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. ooc-3 homozygotes lay fertilized eggs that do not hatch. Oocytes not rescuable by fertilization with N2 sperm.
SP433 C. elegans unc-4(e120) ooc-1(mn250)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and Sterile Unc-4's. ooc-1 homozygotes lay fertilized eggs that do not hatch. Oocytes are not rescuable by fertilization with N2 sperm.
SP444 C. elegans unc-4(e120) spe-7(mn252)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Paralyzed Dpys and Uncs which are sterile.