SV85 |
C. elegans |
cdk-1(he25)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
he25 is temperature sensitive. At 25C: Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. At 15C: Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes) and cdk-1 homozygotes which are slightly smaller than WT, complete nearly all cell divisions, are sterile and have less germ cells than N2 (sperm are present but no oocytes). Previously called ncc-1(he25).
|
|
SV92 |
C. elegans |
cdk-1(he26)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he26).
|
|
SV93 |
C. elegans |
cdk-1(he5)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he5).
|
|
TY3837 |
C. elegans |
dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|
TY4381 |
C. elegans |
dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|
UDN100083 |
C. elegans |
unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complemement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP udn45 homozygotes (larval arrest). Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping.
|
|
UDN100169 |
C. elegans |
unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complemement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP udn45 homozygotes (larval arrest; very few escapers grow into Dumpy Unc adults). Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] banlancer.
|
|
VC2972 |
C. elegans |
R148.3(ok3525)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
R148.3. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3525 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGAGACAACAGTGAGCCGAC. External right primer: GCTGCCTTCCATGACTTCTC. Internal left primer: CTCATGCTCAACGTCAGGAA. Internal right primer: TGTCGATCGTCTTCTCATCG. Internal WT amplicon: 1190 bp. Deletion size: 862 bp. Deletion left flank: GACGGCGGAGAATCGAGATTTGACAGATAA. Deletion right flank: TCATCGATGAGAAGACGATCGACACGTCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3566 |
C. elegans |
clpf-1(ok3753)/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3575 |
C. elegans |
sma-2(ok3109)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3983 |
C. elegans |
mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.
|
|
VC4099 |
C. elegans |
C29E4.12(gk5046[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal deletion balanced by qC1. Deletion of 304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTACATTTTCAAAATTAAAGTATGGCCT ; Right flanking sequence: TGGCGAGAAGAGTGTTGAAGAGGCTGCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4237 |
C. elegans |
nifk-1(gk5029[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal or sterile deletion balanced by qC1. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: CAGATCTCAGACACAATGGTTGCCCAGAAT; Right flanking sequence: CCCGTCCAGCTGCTGTCGAAAAGAAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4238 |
C. elegans |
R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal or sterile deletion balanced by qC1. Deletion of 1366 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: TCATTTTGTATAATGTTTTATTCTCGGTCA; Right flanking sequence: GGAGGTAGAATGCACTCGTATAAAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC534 |
C. elegans |
pal-1(ok690)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
C38D4.6. Deletion balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok690 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VT2797 |
C. elegans |
pat-3(st564)/qC1 [dpy-19(e1259) glp-1(q339)] III; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Heterozygotes are superficially WT (with DTC migration defects), and segregate superficially WT (with DTC migration defects), sterile ts-Dpy qC1 homozygotes, and st564 homozygotes (PAT lethal). Pick WT and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VZ454 |
C. elegans |
gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.
|
|
WM98 |
C. elegans |
sma-2(e502) ced-7(n1892) cdk-1(ne236)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT, Smalls which produces dead eggs, and Dpy Steriles. Throws males.
|
|
WS1609 |
C. elegans |
unc-69(ok339)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and arrested L1 coilers. Fails to complement unc-50.
|
|
XA4900 |
C. elegans |
rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
|
|
XA6226 |
C. elegans |
mrg-1(qa6200)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. qa6200 has maternal effect sterility and maternal effect embryonic lethality.
|
|
XA6227 |
C. elegans |
mrg-1(tm1227)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. tm1227 has maternal effect sterility and maternal effect embryonic lethality.
|
|
YS2 |
C. elegans |
cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
YS4 |
C. elegans |
cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|