Dpy. Unc.

Dpy. Temperature sensitive Muv. Abnormal cell death.

wgIs344 [F49E12.6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs679 [C52E12.1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of T05E12.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ATATTTTTAATATTTTTTATTTTTCGACTCCAGGC. Right flanking sequence: GCAAGgtaagtaagaattattgttttttatttatt. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTCTTACTTACCTTGCGCC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

rdIs24 [F12E12.5::GFP + unc-119(+)]. Spontaneous integrant of UL1189. Expresses GFP in somatic gonad during L2-L3 stages. Reference: Large EE, Mathies LD. Dev Biol. 2010 Mar 1;339(1):51-64.

C32E12.3. Homozygous. Outer Left Sequence: CGAATATTCCCGAAAAACGA. Outer Right Sequence: CCACGACTTCTCCCTTTCAA. Inner Left Sequence: AATCCCAGTGCAGGCATATC. Inner Right Sequence: ATTTCCAGCACCATTATCGG. Inner Primer WT PCR product: 2824. Deletion size: 983 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.13 Homozygous. Outer Left Sequence: GAAAGTTCCAATGGGCTCAA. Outer Right Sequence: TCAACATTTTGAGCAGACGC. Inner Left Sequence: TCGTTGTCAAACCATTTCCA. Inner Right Sequence: TTGAAACCGCCAAGTGATTT. Inner Primer PCR Length: 3345. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04E12.7 Homozygous. Outer Left Sequence: atttcaccttcagcaccgtc. Outer Right Sequence: acggcagaaaacaatgttcc. Inner Left Sequence: tgcttttcacaaatcaacgg. Inner Right Sequence: ctgcgctttttccttcattc. Inner Primer PCR Length: 2174. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E12.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25E12.4 Homozygous. Outer Left Sequence: gcggaaagatcgttcatgtt. Outer Right Sequence: tcaggagcagcagggttaat. Inner Left Sequence: cttcaggttccccacacatt. Inner Right Sequence: cggctccattgttatgcttt. Inner Primer PCR Length: 3330. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25E12.8. Homozygous. Outer Left Sequence: AATCCGCTGATCCAACAAAG. Outer Right Sequence: AATTGGTTTGGGCTCAACTG. Inner Left Sequence: TCTCTCAAGAGGGTCGTCGT. Inner Right Sequence: TCAATTTGGTCTCCCTCCAG. Inner Primer PCR Length: 2159 bp. Deletion Size: 1155 bp. Deletion left flank: TCAAATAGGATTACAGGAAAATAATGCGAT. Deletion right flank: CAGAATTCAATGTTCACTAATCAATAGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35E12.8. Homozygous. Outer Left Sequence: TGAAAAAGCTGTGCAAGTGG. Outer Right Sequence: GGGCAGTTTCCAAATCTCAA. Inner Left Sequence: GCAGCACAATGAATCTGGAA. Inner Right Sequence: AGTTTGATTGGCCAAAGTGC. Inner Primer PCR Length: 3078 bp. Deletion Size: 1014 bp. Deletion left flank: AAATTCAAATCAGTGAGATAAACCATACTA. Deletion right flank: AATTCAAAACATATTTTAGAAAGTTATCTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25E12.7. Homozygous. Outer Left Sequence: TGGCTGCCTTGCTAGAAAAT. Outer Right Sequence: GTTATTGCACGGGAGACGTT. Inner Left Sequence: GACATTCACACAATCACCGC. Inner Right Sequence: GGGAAAGTGCTCAACTACCG. Inner Primer PCR Length: 2219 bp. Deletion Size: 1334 bp. Deletion left flank: GGTGCCACTCTTTTTTCCATAAAAAGTGAA. Deletion right flank: AATTTTAGAAATTAAAAAAAAAATCACATA. Insertion Sequence: AAATTTTAGAAATTAAAAAAAATTTTAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1880 bp. Deletion left flank: CCTGACCGACCTTGTGCATACCGATCCACG. Deletion right flank: GTGATAACGTTAAAGAATGGTGCCATATAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04E12.8. Homozygous. Outer Left Sequence: AGTTGTTCGCATCCCTTTTG. Outer Right Sequence: ACACAACCCGGACACCTTTA. Inner Left Sequence: CAAAACCCCTGGATCAACTG. Inner Right Sequence: CATGCTTCTCGCACATTTTG. Inner Primer PCR Length: 3140 bp. Deletion Size: 1387 bp. Deletion left flank: AGGCAGTTGTTTGGAGCGGCCGACACGTTC. Deletion right flank: AATTTTTATCACACAGTTTTTGTTTTAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47E12.3 Homozygous. Outer Left Sequence: attgaacagcggggatattg. Outer Right Sequence: ctaggggcttgaatctgcac. Inner Left Sequence: cgattccattcgatcttcaa. Inner Right Sequence: attttcaggagacgcagacg. Inner Primer PCR Length: 1158. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02E12.8. Homozygous. Outer Left Sequence: GACATTTGACGGTTCCGTTT. Outer Right Sequence: GCGAAATTGTGCATTTCTTG. Inner Left Sequence: CGATCCGTAACTTGGAAACAA. Inner Right Sequence: GAATTAGGAGCACACGACCA. Inner Primer PCR Length: 1151 bp. Deletion Size: 386 bp. Deletion left flank: TACTCAAGAAGATGCATAGGTTAGTCCAGC. Deletion right flank: CGCAATGGCTTTAGACAGATTATGCTTACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E12.2. Homozygous. Outer Left Sequence: GTGGCTTCAACTGGAGAAGG. Outer Right Sequence: CTATGTTCCTGCCGGTTGAT. Inner Left Sequence: TCGGAGTTGTTCAAATGGTG. Inner Right Sequence: CAAATGTGTTGTTATCCAAAATGA. Inner Primer PCR Length: 1115 bp. Deletion Size: 410 bp. Deletion left flank: GAGTTGCATTGGAAGTATTGGCATATCATA. Deletion right flank: CCAAATTGGAGGTTAGATTTCCAGATTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25E12.9. Homozygous. Outer Left Sequence: CTGGAGGGAGACCAAATTGA. Outer Right Sequence: ATTTTCTAGCAAGGCAGCCA. Inner Left Sequence: TGCAAATGAACCAACTCCTG. Inner Right Sequence: CTGCAAACCATGACAACTTCA. Inner Primer PCR Length: 1140 bp. Deletion Size: 549 bp. Deletion left flank: AGAGTGTCAGCACGAATCGGTTCTCGTTTC. Deletion right flank: GTGTAGATCCACCGAGGTTCATGCAAGCCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21E12.3 Homozygous. Outer Left Sequence: ataccgtaatcgggtgttcg. Outer Right Sequence: catgcaacactggctcattt. Inner Left Sequence: gattcgtaacgctcgatgtg. Inner Right Sequence: tgatcagcaattgccctaga. Inner Primer PCR Length: 1340. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35E12.5 Homozygous. Outer Left Sequence: tccatcgcaaatgattgtgt. Outer Right Sequence: taatgccgataaaagtgggc. Inner Left Sequence: tgcatcagcattatcatggaa. Inner Right Sequence: ataaaaggagcgacggacac. Inner Primer PCR Length: 1149. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E12.4 Homozygous. Outer Left Sequence: ttttcagagcagcaggatga. Outer Right Sequence: cggtggactttttcacgaat. Inner Left Sequence: caaggatgaaaggaatttggaa. Inner Right Sequence: tgaatgtgcaaaaacccaaa. Inner Primer PCR Length: 1212. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.3 Homozygous. Outer Left Sequence: tgtttttgtgcttttcggtg. Outer Right Sequence: gttcagctcgattgtgggat. Inner Left Sequence: tgggccccaactataacatt. Inner Right Sequence: ccgaaattggcatcttgttc. Inner Primer PCR Length: 1219. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09E12.2 Homozygous. Outer Left Sequence: ttgctggaatcgaattttcc. Outer Right Sequence: gtgtcgttctgctcatcgaa. Inner Left Sequence: caaactgccggagttgaaat. Inner Right Sequence: ggcacaacttgcttgctattc. Inner Primer PCR Length: 1189. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12E12.6 Homozygous. Outer Left Sequence: agatgagaaacggagagcca. Outer Right Sequence: ggggatttcttcgaatcaga. Inner Left Sequence: cgtacaacttgagcaaaaagtga. Inner Right Sequence: tgttttacccacgtaaaatgga. Inner Primer PCR Length: 1203. Estimated Deletion Size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22E12.2. Homozygous. Outer Left Sequence: TGTCGCCACGTAATCACATT. Outer Right Sequence: ATCCTCGTGCCACTCACTTT. Inner Left Sequence: ACACTTCTCCTCAACCCCCT. Inner Right Sequence: TGGCAACTTGCAAAATGTGT. Inner primer WT PCR product: 2460. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52E12.2. Homozygous. Outer Left Sequence: AAGGTTTTGGAAAGATCGCA. Outer Right Sequence: CGACTTTCCTTGGAGCTCTG. Inner Left Sequence: CATTTGCTTCTTTTCCCTGC. Inner Right Sequence: GGCTCACATCTCCACAGTCA. Inner Primer WT PCR product: 3024. Deletion size: 1285 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous sterile, Pvl. Deletion of 1629 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ non-Dpy Pvl sterile adults (ve631 homozygotes), Dpy non-GFP (dpy-9(e12) homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: acaatggaaatcggagTTATAATAATTCCT ; Right flanking sequence: CGGTTAGCTTCATaatttctattgaggggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

stIs11859 [C52E12.1.1::H1-wCherry + unc-119(+)].

Heterozygotes are WT and segregate WT, Dpys and Pats. Maintain by picking WT and checking for correct segregation of progeny.

leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk434 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk511 homozygotes (late larval arrest or sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A11.1. Homozygous lethal deletion chromosome balanced by morphological marker. Heterozygotes are WT, and segregate WT, Dpy (dpy-9 homozygotes), and ok1603 homozygotes (probably sterile adult with protruding or ruptured vulva). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTCACCCTCTCTCCCACCT. External right primer: AAGCAGTGGGTTGAAAAACG. Internal left primer: CAGCTGAAAAATGAACGCAA. Internal right primer: GTGTTGGCCGCTGTATCTTT. Internal WT amplicon: 2748 bp. Deletion size: 1903 bp. Deletion left flank: AAACATACCAGATGTTTTGCAGCTTCTCGA. Deletion right flank: GCAAATTTGGCAAATTTGCCGAGCTCGGCA. Insertion Sequence: ATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02D3.5. Heterozygotes are WT and segregate WT, Dpy-9 and grotty sterile adults with vulval blip (ok269 homozygotes). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1891 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 744 bp. Deletion left flank: TCAGACGACACAACTCTCGATCAAATGGTA. Deletion right flank: AGAAGGAAGGTACTGTGGAAAATTTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1911 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATGTTTCAACAAGCAGCGA. External right primer: AGTGGCACGGATAAGGATTG. Internal left primer: CACAACCGCAACAAATGAAC. Internal right primer: GATGAGTGATTCCAGGCGTT. Internal WT amplicon: 3035 bp. Deletion size: 918 bp. Deletion left flank: ATGAAGTACGTACACAATTCTCAAAGTATT. Deletion right flank: AATTAATTGCAACAATGTATCAAACTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.13. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E12.6. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk896 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 1777 bp. Deletion left flank: GTTTTGGGAATAAAGCATCTCACAAATAAA. Deletion right flank: CGAATCTACGATATTGTCAATGTAATGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12E12.5. External left primer: CTTCATCTCGCACTGACCAA. External right primer: ACAGTTGGCAGCTGGTCTTC. Internal left primer: AGAGCTTGAGCTTCAGGCAG. Internal right primer: GACGCCGTATTGTCGCTTAT. Internal WT amplicon: 1748 bp. Deletion size: 642 bp. Deletion left flank: TCCTGAAGAGCTTTTGAGTTGATGAAAGTG. Deletion right flank: AAATTGCTGGAATTGAACAGGAAAAATGGA. Insertion Sequence: ACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable, carrying a deletion in R02E12.4. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R09E12.3. External left primer: TCCCTATTTTCAGGCGATTG. External right primer: CGACGTCACCAAAGAAGACA. Internal left primer: GATCTCGGAAATGCTGCCTA. Internal right primer: AAGACGAGTCCAGAGGACGA. Internal WT amplicon: 1160 bp. Deletion size: 336 bp. Deletion left flank: TGAGTGGTCGAAGGCTCAGCGAGCCTACGA. Deletion right flank: CCCCATGGTCTGTGTTTTTTGCATCTCGCT. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02E12.8. External left primer: GACATTTGACGGTTCCGTTT. External right primer: GCGAAATTGTGCATTTCTTG. Internal left primer: CGATCCGTAACTTGGAAACAA. Internal right primer: GAATTAGGAGCACACGACCA. Internal WT amplicon: 1151 bp. Deletion size: 418 bp. Deletion left flank: TTGCTTCTCATGAAACGTCCAGGAGTGTTC. Deletion right flank: AAGTGCATAGATGATGCAAAACTCAGAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk17 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807