ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2381 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 456 bp. Deletion left flank: TTCAAAATGGAGTTTGATATCAAAAAAGTG. Deletion right flank: ATCAGAAGGAGAAGACGCATCGGATTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04H5.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2708 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCTTCGCCTGCAAATCAC. External right primer: TTCATGCCGTACCTGTTCAA. Internal left primer: TCTTCGATCCCAGTGCTTTC. Internal right primer: AAGGAGCAAAACTTCGATGG. Internal WT amplicon: 3202 bp. Deletion size: 2453 bp. Deletion left flank: ATACCAAAATATCGCCGGGAAGTGGCTGGG. Deletion right flank: GCGAATAAAAGTCGAAAAAAAAATGTTTTG. Insertion Sequence: ATTTTTTTTCGTTTTTTTTTGGGTTTATTCGAAGTATTGATTAAAATTTAAGAGCGATC GATTTTTTTCTTAATTAAAAACAAAAATCCTGAATGTTTGGTTTTTTTGCTGTTTTTGT AAATGTTCTAAAAATTACCTATAACTAGCCAAATCGGGTTCGTTGAGAAACTCTCTGAG CAGCATTCCGTCTGTCATGTATTTGAGGACAGTCTTCTCCGATGTGCAATCCTCGAAAC GAATACTGTAGCCGACCTGGAAAATGGAAGCGTTTCGAAAGAAAAATCGGAATCTGTTT TCCTCGTTTTTTTACAAGTTTAAAAATTTTTAGAAGCGGCAAAGAATTGCCCAAATTTT TTTAACTTCCAGTTTTTTTTTCTAAATTTTGGAATTTTCCGACTAGAATGAAACTTAGT TTATTTTCGCCAATTTCCAAAAACCACCCAACCTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33H1.4. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk953 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGCCATTCCTTGAAAGGTT. External right primer: GCTAGTAGTCGCTGATCCCG. Internal left primer: GAGGTACCCGTAGATCGCAA. Internal right primer: CGAAATCCGTTCTCCATCAT. Internal WT amplicon: 2555 bp. Deletion size: 836 bp. Deletion left flank: TTGCTCCAAATGCGGGAATTGAAGATAATA. Deletion right flank: GAAGATCGTATTGGTAGATCTGATTTAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2877 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTGGACAGCGTTTGCTT. External right primer: CCATGATTAAACCAGACGGG. Internal left primer: TCAATCCATTGGGCATTTTT. Internal right primer: GGAATTACCTGCAATGGCTC. Internal WT amplicon: 1331 bp. Deletion size: 689 bp. Deletion left flank: AGATAATAATTTATACGAGAATATAGAATC. Deletion right flank: GGTTTCGTCATTTCTCGATAGAATTTGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38F1A.10. Apparent homozygous lethal deletion chromosome balanced by recombination suppressor marked with dpy-10 and unc-52. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok2553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGACAGAAATCGACAGCAGG. External right primer: ACGGGAACCCCCATATACTC. Internal left primer: AAGCGGTAAATGACGGAATG. Internal right primer: TGTGTCTGTGTGTCTTCGCA. Internal WT amplicon: 3342 bp. Deletion size: approximately 2000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M88.6a. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous gk142 hermaphrodites (dpyish L1 or L2 larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52H3.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2786 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCGAAGCATTTTTGCCT. External right primer: CGACCCGAAGAATTGACATT. Internal left primer: GGAAAAACGCGACTGTCAAT. Internal right primer: CACGAAAATTATCGGGATGC. Internal WT amplicon: 1138 bp. Deletion size: 467 bp. Deletion left flank: AGTTCATGCAAGACTGAACAAGAAGACCAC. Deletion right flank: CTGAAAGTGTTTCAAGAAGGCATGGTATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54B3.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3093 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAAAATCTGTTTTGCAT. External right primer: CGTAATCGAGTCCGGAATGT. Internal left primer: CACCATCCCAAGCTTCAATC. Internal right primer: CGAAAAGTGTCTTTCCGGTT. Internal WT amplicon: 1152 bp. Deletion size: 391 bp. Deletion left flank: ATGCAGGAAGAAAGCCTCCGAAAACAAGAA. Deletion right flank: TCACTCCACTTGAAGTACTCAAACACCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06A4.7. Homozygous maternal-effect sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2480 homozygotes (maternal-effect sterile). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGTTTCGTGCTCCGTGT. External right primer: CGTCTCTTCGCATAGAACCC. Internal left primer: GTATCGAGGTTGGCGACATT. Internal right primer: CGTGCCAAGTTTCCAATTTT. Internal WT amplicon: 3364 bp. Deletion size: 1262 bp. Deletion left flank: CTATGGCCAAACAAAAGTTCACAGAGAGAA. Deletion right flank: GCCAATCACAGCGTGTCGACATGCGGGTGA. Insertion Sequence: GAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1127.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1940 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAATGGATTGCCGAAGA. External right primer: GGGAAGTTCGTAATCGGTGA. Internal left primer: TTTCAGGCCAAATGTCCTTC. Internal right primer: CTGACAGCTCACACCACGAT. Internal WT amplicon: 2174 bp. Deletion size: 1250 bp. Deletion left flank: TGGAAGCATTCGTGAAGATTTGTCCGGCTT. Deletion right flank: CCTTCACGGTTGGCCCTGCTTTGAAGCTTG. Insertion Sequence: AGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05G5.3. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1881 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 1140 bp. Deletion left flank: AATCGGCGAAGGAACATACGGAGTCGTCTA. Deletion right flank: TCGTCTTCCGTGTATTGTTTAACTATCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21H12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3196 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGACTGCGAACATTGGGTAG. External right primer: CATACCGGGAGTCTGCTTTC. Internal left primer: CAAGACCGAGTGTCGACTGA. Internal right primer: TGGCCAGAAGTGATGTCTGA. Internal WT amplicon: 1140 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09F7.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3162 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACCCAACAGCAGGCACTC. External right primer: TTCGACAATTCCGTCATCAA. Internal left primer: TGTTACCTCAAAAGTCAAGGCT. Internal right primer: CGATTGGTTAGAGAACGGGA. Internal WT amplicon: 1204 bp. Deletion size: 794 bp. Deletion left flank: ACGTTTGGAGCTCGCTGGATCATTGCTTTC. Deletion right flank: TGGTGAAAGCCGTCAGAGATTTGAGAAGGT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C10.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2851 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCTTTTGCTGCGTCCAAAC. External right primer: ATGCCCGTATTGCAAAGAAC. Internal left primer: TTTTTGTCAATTTTTCGGGA. Internal right primer: CAGAGAATGTTTAAAAATCCGTTAG. Internal WT amplicon: 3016 bp. Deletion size: 1577 bp. Deletion left flank: CTCCCTGATTCTCTCGATTCTATGGACTTC. Deletion right flank: AAGAATAAATAAAGTCGTAATTTTTTTTTC. Insertion Sequence: TCTCGATTCTATGGACTAAAATTAAACAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK430.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3194 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATTTCAGGAGTTGCGGGAC. External right primer: GTCCCATTTCTCTCCGTTCA. Internal left primer: TGATACAGAATTCGCCAACG. Internal right primer: CATTCGGTCGCCTTATTGAT. Internal WT amplicon: 1374 bp. Deletion size: 812 bp. Deletion left flank: TCGAAAAGCTTCTTCTGGAACTTTCTCCGT. Deletion right flank: CTTATAGAAACTATTGAAGATGCTTCGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F6.5. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2796 homozygotes (sterile, lays eggs that don't hatch). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTGGGGCACTGAGATTTT. External right primer: CATGAACGTAATTCGGCAAA. Internal left primer: AAGTGCTCATGCGCTTCAAT. Internal right primer: CGATTTCCCAGAAAAATGGA. Internal WT amplicon: 1174 bp. Deletion size: 718 bp. Deletion left flank: CTCTTTTTTTTTAATTAAACATTTTCATAT. Deletion right flank: AGCCCATTCGACGCATTCCACAGCATGCTC. Insertion Sequence: ATATGAAAATATGAAAATGTTTAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y32H12A.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3136 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAGAACGCGAAAACAAGA. External right primer: CAGGACATCGTCCTCCACTT. Internal left primer: GGAACGAAAAGGGGGAATAA. Internal right primer: CGTTCAGTAGCTGCTTCAAGA. Internal WT amplicon: 1358 bp. Deletion size: 299 bp. Deletion left flank: AAAAGCGGCGAGCACGACAAATGTGTGAAA. Deletion right flank: TATACATGGCTCCCATCATAATCATCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38E4B.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2517 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTTTGGCCTAAAAATCGCA. External right primer: ACCACATCCAATGCACAAGA. Internal left primer: CGCGGAGCAACTGATTTTAT. Internal right primer: TTCACTGGGCAAGCTCTTTT. Internal WT amplicon: 2301 bp. Deletion size: 1379 bp. Deletion left flank: TTTTAACATTAAAAATGATCTATATTTACC. Deletion right flank: GTTTTCCATCCAATTTCATTGATTTTTGAG. Insertion Sequence: TATATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2650 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTGGAGCGTAATTTTTCA. External right primer: CGACATTTTGCGGACTTTTT. Internal left primer: GGCACGGTTTTCCTCTTTTT. Internal right primer: GTGGCTGGTGATTTTTCCAC. Internal WT amplicon: 1226 bp. Deletion size: 520 bp. Deletion left flank: TTTCTCCAGAAATATCGATTTTTTAAAAGC. Deletion right flank: CGGAAAGCGTCTCCTTCAACGGTAGAAGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45G2.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1721 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATTACCAGCGGACTGT. External right primer: AGAGGCAAAAGCAATGATGG. Internal left primer: TCCGATCAAGCTGAACTGTG. Internal right primer: CGCCTTTTCTCCCCTACTTC. Internal WT amplicon: 2848 bp. Deletion size: 954 bp. Deletion left flank: AAAACGGGGGTGAAGCCATTTACTTTCAGG. Deletion right flank: ATTTGGTTATAAGATGATGGCTTGTGCATG. Insertion Sequence: TCTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E2A.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3305 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATTCGCTCAAAATCCATGC. External right primer: AAAATAAATGATGACGCGGG. Internal left primer: ATCAAAACAAATTCGGCCTG. Internal right primer: TTTTCACGAAAAATGTCGGTT. Internal WT amplicon: 1236 bp. Deletion size: 812 bp. Deletion left flank: CGCTGTATCTTTGGCGCGAAAATTTAGAAG. Deletion right flank: TTTAGCAATTTTTCAAAGCTTCTCACCATC. Insertion Sequence: CAATTTTTCAGCAATTTTAGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56F3.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATGGAACCACAGGTTGGTGT. External right primer: ATCAAGAAAGATCGATGGCG. Internal left primer: CACGGGACATCATCATCTTG. Internal right primer: GTGAGGAAACTGCTGGAGGA. Internal WT amplicon: 1110 bp. Deletion size: 568 bp. Deletion left flank: CTCTTGGTTGCTCTCTGGCGGGCTCTGACT. Deletion right flank: GGATCTTGCAATGGACTGACTTTTGAAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1248.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3390 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTCGTCGTTTTTCATC. External right primer: AGTGAATTTCGGTCAATCGG. Internal left primer: GCGCTCAGGATAATAGAACAA. Internal right primer: TTCTGTTTGAATTCCTCGCA. Internal WT amplicon: 1190 bp. Deletion size: 590 bp. Deletion left flank: ATTTTGGTTCCTTACTGTTTGTTAGAGCTT. Deletion right flank: GAAACCAGTAAGTGATAATTTCCTTTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R05H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2875 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCACCAACGTAACACCA. External right primer: ACTCTTCTTGGCAGTGCGAT. Internal left primer: ATTCGGATCCACAGACTTCG. Internal right primer: AAGAGAACAAGCAAGACGGC. Internal WT amplicon: 1173 bp. Deletion size: 616 bp. Deletion left flank: ACATTCCAAAGTCAGCCATCTTGACGACTC. Deletion right flank: AGAAGTTTTTCCACCGATCTTCGCCGTCTT. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3404 homozygotes (sterile with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCGAGATTTGGAGAAATGA. External right primer: AAGGCGCAGGACAACTACAT. Internal left primer: CAACAACATTCACAATCTTCATCA. Internal right primer: TGTGTGTCCTTTTCCCGTTT. Internal WT amplicon: 1124 bp. Deletion size: 643 bp. Deletion left flank: CTTAATTCCAGCTTCCTCAAGAGTTTGATT. Deletion right flank: TTTCTTTGTTGAAAGCGTCTTGGATCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1010.2, ZK1010.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2028 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCCAATTCAGGTCGTTCC. External right primer: TCATATCGAATTCATCGGCA. Internal left primer: TCCAAATGTTTTCCCGAGAG. Internal right primer: CTGGACGCTTGTTCAGCATA. Internal WT amplicon: 2149 bp. Deletion size: 896 bp. Deletion left flank: TGAAGCAACTGGGCGTCTCTTCTTCATCTT. Deletion right flank: GATTTTTCTTTAGAGACTAGTTTCAAAGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29C12.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3372 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACGAACGGAAAACAACG. External right primer: GTGCATTTTTATTCCCGCAT. Internal left primer: CGCGTACTCCTCTCGGATAA. Internal right primer: TGGGACATATTAGCACCACG. Internal WT amplicon: 1208 bp. Deletion size: 371 bp. Deletion left flank: TTATTTTTAAATTATTTTAATAGTTTTTTT. Deletion right flank: ATTATTGATACACCAGGCCACGTGGATTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43F4B.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2481 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCCCATGAAGTTTGTCGT. External right primer: ATTGTGCGTGAACTCTGACG. Internal left primer: TTCTCATCGACCCGATTTTC. Internal right primer: TTTGATTTCAAAAGCCTCCG. Internal WT amplicon: 3279 bp. Deletion size: 1984 bp. Deletion left flank: AGACAAAATAGGACAATGGGAAAAACAGAC. Deletion right flank: GGTGTTCATGATTCTTTGGAACAACGCACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M142.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3554 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCCCTCAAAAATCACGAC. External right primer: CGATTGGAAATTATCGGGAA. Internal left primer: AATGTTCAGTGTGGGTTCGC. Internal right primer: TTTTTAAATCGGCTTCAAATTCA. Internal WT amplicon: 1168 bp. Deletion size: 467 bp. Deletion left flank: TTTATCGACCCGTTTTTGTGCAGTTTCTTG. Deletion right flank: TACACGGACCACCGAACGGCTCGACAAAAC. Insertion Sequence: ACCGTTTTTGTGCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48E1B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3557 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCGCGTACTTCTCCAACAAT. External right primer: TCTCGCAATCGGAATCTTCT. Internal left primer: CAGCTCTCTCCACCGTCTTC. Internal right primer: ACGTTCAGGAGGTCACCAAC. Internal WT amplicon: 1169 bp. Deletion size: 674 bp. Deletion left flank: GCAAGCCTCGGGTAGATGCTTCCGGGAAGA. Deletion right flank: CAGAATCTTCTGATAGCTGGGCTCCTGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0495.7. Maternal effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3607 homozygotes (first-generation homozygotes viable and fertile, but F2 arrests as grotty L1 or L2). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACTCAGGATTGATCGCGT. External right primer: TTGGTGTGAATCGTCTCGAA. Internal left primer: ACACATTGGCTGATGGCATA. Internal right primer: CGTCCATCTGGATGTTTTGA. Internal WT amplicon: 1316 bp. Deletion size: 797 bp. Deletion left flank: GCAATGATAAGAAGCATTGTAATTACCATT. Deletion right flank: TCCCTTCTTCGGACCAATTCTCACAACGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M176.1. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and ok536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok544 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03C10.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3357 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCTCTCGGCTTCATTCACC. External right primer: GTGTAAAGTCCGCGAAGAGG. Internal left primer: ATACTCGGAAACCCGCTTCT. Internal right primer: ATGCCTTCGAATTTACAGCC. Internal WT amplicon: 1159 bp. Deletion size: 691 bp. Deletion left flank: TTCGATGGCCACAGCGTCCTTGATGATATC. Deletion right flank: TGCCTTTTTGTAGAAGTTCCAGATGTCATG. Insertion Sequence: ATTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK945.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3447 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGTGATGATCGAGGAAGCAG. External right primer: TTCGTCTCTCCCGTAAATCG. Internal left primer: AAGCAGTTGCCGCATAACTT. Internal right primer: AACGGTTCTTCTGATTTCCG. Internal WT amplicon: 1263 bp. Deletion size: 409 bp. Deletion left flank: GAATTGTGCATAAACATGTTTCTGGTTTGT. Deletion right flank: ATTCACATCCAGCTCCTCGATCTTCAGCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32A5.7, F32A5.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3151 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GTTGGAGGTGCGGACATTAT. External right primer: ATGATCATCCACCAACGACC. Internal left primer: GGAATGTCGTTATTCGATTTTGA. Internal right primer: TTTCGAATTGTCTTTTCGCC. Internal WT amplicon: 1193 bp. Deletion size: 437 bp. Deletion left flank: ACCACCACGACCACGGGATTGCTCGCGCTG. Deletion right flank: AATATTCATCCACGAATCGCAGGCTTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F5.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3457 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCGATGGAATTGGACAACA. External right primer: ATTGTAGGCCTGATGCAAGG. Internal left primer: AGGCCATAATGAAACATCGC. Internal right primer: GTGAAGGCGGCATCTAAAAT. Internal WT amplicon: 1188 bp. Deletion size: 602 bp. Deletion left flank: GAATGGGCAAACAATGGAAGCTCTGACAGA. Deletion right flank: CAGCTAAGAGGTCTCGATAAGATGGCTGTC. Insertion Sequence: GGAAATTCGAAAATGGCTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3493 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 531 bp. Deletion left flank: ATTGAGTTTTTTCTATGAAAGACCTAGCGC. Deletion right flank: AAAAATAAAATAAATAACACGGAAACCGCG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807