VC3004 |
C. elegans |
F59E12.3(gk1277) II; srxa-9(gk3141) X. Show Description
ZK678.4, F59E12.3. The gk1277 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 588 bp. Deletion left flank: AGGCAATAAATGTTCATTATCGACTGCCAT. Deletion right flank: ATCGATGGACTAAGCTTCTTTGAGGAGCCA. The gk3141 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3026 |
C. elegans |
C52E12.6(ok3724) II. Show Description
C52E12.6. External left primer: GAAAAGAGAAGCAGCCATGC. External right primer: CGTTTTGCTGAAGAAGGAGG. Internal left primer: ATTTCCAGATTGCTCACGCT. Internal right primer: TACCCTCCATAAACCACCGA. Internal WT amplicon: 1156 bp. Deletion size: 585 bp. Deletion left flank: GATGCACATGGATATTTGGGTATGTGTGAC. Deletion right flank: AAAGTTTAGGTTTAATAGGGTAATACACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3090 |
C. elegans |
mop-25.1(ok3762) X. Show Description
R02E12.2. External left primer: TTTTGGGCGTTTTTCTTACG. External right primer: ACAGAAGCTGTTGCCGAGTT. Internal left primer: GGAAATTTTGAACGACCACAG. Internal right primer: GAGTTGTTTTACAGGAATTCTCCA. Internal WT amplicon: 1136 bp. Deletion size: 392 bp. Deletion left flank: TTTCAAATATTCCATGACCACCCAAAAAAA. Deletion right flank: CATCCGCACAAGCTGTCTTCATCGTACTGT. Insertion Sequence: ATCTCGCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3121 |
C. elegans |
T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC396 |
C. elegans |
egl-9(ok478) V/nT1 [qIs51] (IV;V). Show Description
F22E12.4. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- Egl adults (ok478 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC4273 |
C. elegans |
F59E12.1(gk5356[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1652 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACTCTTGTTCTTCCTCCAACCAAGCCTCCC; Right flanking sequence: TTGGGTGAAGCAACATACGATCAAGGAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4651 |
C. elegans |
C47E12.2(gk5720[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1528 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCAATAGGATAACAAAAAAACGATCCTCAT. Right flanking sequence: CCACACGAAACATCACATGTGACGAGCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC552 |
C. elegans |
alx-1(gk275) III. Show Description
R10E12.1. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC575 |
C. elegans |
egl-9(gk277) V/nT1 [qIs51] (IV;V). Show Description
F22E12.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk277 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC841 |
C. elegans |
alx-1(gk338) III. Show Description
R10E12.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC900 |
C. elegans |
alx-1(gk412) III. Show Description
R10E12.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC930 |
C. elegans |
uba-1(ok1374) IV/nT1 [qIs51] (IV;V). Show Description
C47E12.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1374 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
AD226 |
C. elegans |
egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
AG150 |
C. elegans |
apc-1(ar104)/unc-4(e120) bli-1(e769) II. Show Description
Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2.
|
|
AG152 |
C. elegans |
unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
|
|
AG168 |
C. elegans |
fzy-1(av15) unc-4(e120) II. Show Description
Unc. Gain-of-function allele of fzy-1.
|
|
AG226 |
C. elegans |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
|
|
AH286 |
C. elegans |
unc-4(e120) ect-2(zh8) II; gap-1(ga133) X. Show Description
Muv and Unc. Semi-dominant mutation in ect-2 (previously called let-21).
|
|
AH346 |
C. elegans |
dep-1(zh34) unc-4(e120) II; lip-1(zh15) IV. Show Description
Pvl and weak Muv. Transformation of secondary to primary vulval cell fates.
|
|
AMH26 |
C. elegans |
unc-104(e1265) II; sosIs5. Show Description
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc. Slow moving.
|
|
AMH91 |
C. elegans |
unc-104(e1265) II; olaEx3013. Show Description
olaEx3013 [ttx-3p::mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Slow moving. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
|
|
AN170 |
C. elegans |
aff-1(ty4) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), Unc-4 worms which are strong Egl (ty4 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
|
|
AT28 |
C. elegans |
kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
|
|
AT30 |
C. elegans |
kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.
|
|
AV308 |
C. elegans |
him-14(it21)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, DpyUncs (mnC1 homozygotes), and him-14 homozygotes that produce >95% dead embryos and 45% males. Among these surviving progeny, cytologically they have 12 univalents in diakinesis-stage oocytes owing to a failure to form crossovers during meiosis.
|
|
AV828 |
C. elegans |
nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
AV860 |
C. elegans |
nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
|
|
BA1013 |
C. elegans |
spe-6(hc49) vab-7(e1562)/qC1 [dpy-19(e1259) glp-1(q339)] III; spe-27(it132) IV. Show Description
Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.
|
|
BA1061 |
C. elegans |
dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal.
|
|
BA824 |
C. elegans |
spe-26(hc139) dpy-20(e1282) IV. Show Description
Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.
|
|
BA825 |
C. elegans |
spe-26(hc140) dpy-20(e1282)/+ IV. Show Description
Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.
|
|
BA901 |
C. elegans |
spe-27(it110) dpy-20(e1282) IV. Show Description
Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA.
|
|
BA925 |
C. elegans |
spe-26(hc138) dpy-20(e1282) IV. Show Description
Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
|
|
BA959 |
C. elegans |
spe-29(it127) dpy-20(e1282) IV. Show Description
Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons.
|
|
BA969 |
C. elegans |
spe-6(hc163) III; spe-27(it132) dpy-20(e1282) IV. Show Description
Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C.
|
|
BA971 |
C. elegans |
spe-27(it132) dpy-20(e1282) IV. Show Description
Temperature sensitive spe-27 allele. Leaky sterile at 20C. Males at 20C produce spermatids that form spikes in pronase. Males are fertile. Temperature sensitive dpy-20 allele. Maintain at 15C.
|
|
BA975 |
C. elegans |
spe-6(hc163) III; spe-29(it127) dpy-20(e1282) IV. Show Description
spe-6(hc163) suppresses the self-sterility of spe-29 in this strain. Self-sterile at 25C.
|
|
BC11631 |
C. elegans |
dpy-5(e907) I; sEx11631. Show Description
sEx11631[rCesY57E12AL.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BG99 |
C. elegans |
laf-1(q267)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and larval lethals (laf-1 homozygotes). Maintain by picking WT.
|
|
BJS78 |
C. elegans |
smc-5(sbj3)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.
|
|
BJS79 |
C. elegans |
smc-5(sbj2)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP sbj3 homozygotes. Pick wild-type GFP+ to maintain. sbj3 homozygotes are morphologically wild-type but show reduction in viable progeny. Reference: Wolters S, et al. Genetics. 2014 Apr;196(4):985-99.
|
|
BN3 |
C. elegans |
vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
|
|
BN40 |
C. elegans |
npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
BN464 |
C. elegans |
bqSi189 II; mel-28(t1684) unc-32(e189)/qC1 dpy-19(e1259) glp-1(q339) III; ojIs1 Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C to help prevent silencing of ojIs1. mel-28 heterozygotes are wild-type and segregate wild-type, DpySteriles, and Uncs which give only dead eggs. ojIs1 is likely integrated into LG V. bqSi189 is a single-copy MosSCI insertion into ttTi5605 derived from injection of pBN13. Derived from GE2622; this strain might still carry him-3(e1147) in the background. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.
|
|
BN53 |
C. elegans |
vrk-1(ok1181)/mIn1 [mIs14 dpy-10(e128)] II; vrIs13. Show Description
vrIs13 [vrk-1p::VRK-1:GFP:VRK3UTR + unc-119(+)]. F28B12.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1181 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Klerkx et al, Dev Biol. 2009 335:12-21.
|
|
BN69 |
C. elegans |
npp-5(tm3039)/mIn1 [mIs14 dpy-10(e128)] II; bqIs51 ltIs37 IV. Show Description
bqIs51 [pie-1p::GFP::npp-5 + unc-119(+)] IV. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Expresses GFP::NPP-5 and mCherry in the germ line. Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. tm3039 homozygotes are viable but produce progengy that are primarily Lva or Lvl; bqIs51 transgene rescues the npp-5(tm3039) phenotype. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT with dim GFP in the pharynx and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
BN85 |
C. elegans |
npp-5(ok1966)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous deletion chromosome balanced by GFP- and dpy-10-marked inversion. ok1966 homozygotes are viable but produce progengy that are primarily Lva or Lvl. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm3039 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
BP601 |
C. elegans |
aff-1(tm2214)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and few GFP- tm2214 homozygotes animals which give very small brood size and hence can only be slowly propagated (see BP600 for detailed description for homozygote tm2214 phenotypes). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
BP610 |
C. elegans |
eff-1(ok1021) aff-1(tm2214)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal. Segregates Dpy with bright GFP (mIn1 homozygotes). Segregates very few escapers that are non-GFP (ok1021 tm2214 homozygotes).
|
|
BS3493 |
C. elegans |
gld-3(ok308)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok308 homozygotes (mostly sterile or Mel, but can be slowly propagated at 20C). Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|