| CB1065 |
C. elegans |
him-2(e1065) I. Show Description
Segregates males. Recessive. M-MATING+++ 10-30%WT. |
|
| CB2337 |
C. elegans |
him-2(e1065) I; mab-3(e1240) II. Show Description
Lineage abnormal. Recessive. Segregates males. Males abnormal. |
|
| CB3214 |
C. elegans |
smg-1(e1228) him-2(e1065) I. Show Description
Bursae abnormal. Have slightly protruding vulva in adults. Segregates males with abnormal swollen bursae. M-MATING++ 1-10%WT. |
|
| CB3218 |
C. elegans |
him-2(e1065) I; mab-4(e1252) III. Show Description
Bursae abnormal. Vulva protruding. Segregates abnormal males. M-MATING++ 1-10%WT. |
|
| CB3221 |
C. elegans |
him-2(e1065) I; mab-8(e1250) II. Show Description
Hermaphrodites are nearly WT. Vulva slightly swollen. Males have abnormal swollen bursae. M-MATING++ 1-10%WT. |
|
| RG3565 |
C. elegans |
C08B6.14(ve1065[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1767 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATTTTTCCATTAGCATTCTCCCTCATTT ; Right flanking sequence: CGGAAGTAATCCGAGCATTCATTTTATAGT. C08B6.14 crRNA A: TATTTGTATGGAAATGCCCG; C08B6.14 crRNA B: GTATTCATGTTGGAGATACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| XE1065 |
C. elegans |
sup-17(n316) I; oxIs12 X ; wpEx16. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx16 [unc-47p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. GABAergic expression of SUP-17 from wpEx16 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78. |
|
