More Fields
Strain Species Genotype
PHX3936 C. elegans nlp-51(syb3936[nlp-51::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PHX4413 C. elegans flp-27(syb4413 [flp-27::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous flp-27 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
PHX5321 C. elegans bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX5697 C. elegans nlp-2(syb5697 [nlp-2::SL2::GFP::H2B]) X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-2 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. PLoS Genet. 2022 Sep 30;18(9):e1010372. doi: 10.1371/journal.pgen.1010372. PMID: 36178933.
QW1655 C. elegans lin-15B&lin-15A(n765) zfIs149 X. Show Description
zfIs149 [flp-18p(3kb)::mCherry::SL2::FLP-18 + lin-15(+)] X. FLP-18 expressing neurons are labeled with cytosolic mCherry. Overexpression of FLP-18 causes uncoordinated locomotion. Animals exhibit exaggerated head and body bends, increased reversal frequency, and enhanced calcium transients in body-wall muscle. These phenotypes are suppressed by loss of NPR-5. Reference: Florman JT & Alkema MJ. PLOS Genet. 2022 Mar 3;18(3):e1010091. doi: 10.1371/journal.pgen.1010091. PMID: 35239681.
SP1493 C. elegans sma-1(e30) unc-76(e911)/vab-8(e1017) V. Show Description
Heterozygotes are WT and segregate WT, SmaUnc and animals with a posterior half that is thin, pale, uncoordinated.
SU896 C.elegans hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V. Show Description
mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663.
SZ340 C. elegans smg-4(az152) V. Show Description
CRISPR/Cas9 engineered smg-4 null allele. smg-4(az152) allele is confirmed NMD-defective by both the presence of the protruding vulva phenotype and the accumulation of NMD-targeted isoforms. smg-4(az152) is easy to track in crosses by PCR and digestion with BstBI (see S1 text of Suzuki, et al. for sequence of allele) and essentially mimics ma116 in having a G->A mutation at the last base of intron 1. az152 also removes two bases of exon 2 and inserts 50nt in exon 2. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
SZ345 C. elegans unc-73(e936az30) dxbp-1(az121) I; smg-4(az152) V. Show Description
dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
SZ355 C. elegans unc-73(az63) dxbp-1(az52) I; smg-4(az152) V. Show Description
az52 is a CRISPR-engineered M107I missense allele of dxbp-1. az52 has no phenotype on its own, but suppresses unc-73(e936) and unc-73(az63) by promoting use of a cryptic splice site for an intron beginning with UU. smg-4(az152) provides an NMD deficient background allowing identification of out-of-frame mis-splicing in an RNA-seq experiment. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.
UP4013 C. elegans bli-4(cs281) I; csEx919. Show Description
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
WBM1204 C. elegans raga-1(wbm40[raga-1::AID*::EmGFP]) II. Show Description
Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Can be used in conjunction with tissue-specific TIR1-expressing lines to degrade RAGA-1 protein via the Auxin Inducible Degron system. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.
WBM1250 C. elegans raga-1(wbm40[raga-1::AID*::EmGFP]) II; wbmIs83 IV. Show Description
wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.
WBM1438 C. elegans ieSi57 raga-1(wbm40[raga-1::AID*::EmGFP]) II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Auxin-inducible degron (AID*) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Somatic expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the soma. Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 3772195
WBM1481 C. elegans let-363(wbm46[AID*::let-363]) I. Show Description
Auxin-Inducible Degron (AID*) tag was inserted into the endogenous let-363 coding sequence via CRISPR/Cas9. This strain can be combined with TIR1-expressing strains to induce degradation of LET-363. Reference: Smith HJ, et al. PLoS Genetic. 2023 Sep 18;19(9):e1010938. doi: 10.1371/journal.pgen.1010938. PMID: 37721956.
WJA1004 C. elegans unc-54(srf1004[unc-54::T2A::FLAG::rareArg12::GFP]) I. Show Description
Unc. Reporter for no-go mRNA decay. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369.
WJA1025 C. elegans rps-10(srf1025[rps-10::3xHA]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA1190 C. elegans rps-20(srf1190[rps-20::3xFLAG]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA2119 C. elegans znf-598(srf2119) II. Show Description
srf2119 is a 965bp deletion within znf-598. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
WJA730 C. elegans hbs-1(srf730) I. Show Description
srf730 is a 900bp deletion within hbs-1. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369