FX30235 |
C. elegans |
tmC20 [dpy-5(tm9709)] I. Show Description
Break points: In(F53G12.8 T02E1.7 In(gsp-3 sre-23)) I. Covered region (Mb) 8.1 (0.1..8.3) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
GKC1 |
C elegans |
mip-1(uae1) III. Show Description
Temperature-sensitive sterile; maintain at 15-20C. uae1 is a CRISPR-engineered deletion of the mip-1 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.
|
|
HE110 |
C. elegans |
smg-1(re1) I; unc-97(su110) X. Show Description
Variable phenotype-WT when relaxed. Paralyzed. Dave Reiner identified smg-1(re1) in this strain.
|
|
JEL446 |
C. briggsae |
Cbr-met-2(xoe1) III. Show Description
Derived from C. briggsae strain AF16. Reference: Larson BJ, et al. Genetics. 2016 Jun 8. pii: genetics.116.191130.
|
|
JJ1549 |
C. elegans |
efl-1(se1) V. Show Description
Temperature sensitive. At restrictive temperature (26C), efl-1 produces dead eggs with a Mex phenotype. Two ts periods: 1) prior to L4 results in sterility, 2) after L4 results in a maternal-effect embryonic lethal phenotype.
|
|
JJ1972 |
C. elegans |
eel-1(zu462) unc-33(e204) IV. Show Description
Slow growth and a maternal-effect enhancer of the efl-1(se1) embyronic lethal phenotype. Unc.
|
|
JR1763 |
C. elegans |
wcDf1 dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
At 25C, heterozygotes are WT and segregate WT, dead eggs and Dauers (which will give only dead eggs if they exit dauer). e1372 and it46 are both temperature sensitive.
|
|
LG269 |
C. elegans |
geIs3 dyf-x(ge1) I. Show Description
geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain replaces LG100. Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.
|
|
LG394 |
C. elegans |
geIs3 I. Show Description
geIs3 [sir-2.1(+) + rol-6(su1006)]. Rollers. This strain contains the transgene from LG100 crossed away from a linked dyf mutaion. Reference: Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.
|
|
LG398 |
C. elegans |
geIs101. Show Description
geIs101 [rol-6(su1006)]. Rollers. Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.
|
|
LG433 |
C. elegans |
dyf-x(ge1) I. Show Description
Reference: Viswanathan M, Guarente L. Nature. 2011 Sep 21;477(7365):E1-2.
|
|
LV18 |
C. elegans |
unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
|
|
LV19 |
C. elegans |
unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
|
|
MG278 |
C. elegans |
K08E3.5(ok233) III. Show Description
TI223.E1: AGACTTGAAGGAAACGCGAA. TI223.E2: AATCAAATTGAAACGGCTCG. TI223.I1: AATCCTTGCCAACCAAACAG. TI223.I2: CGTAGCATCCTTGGACCAGT. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
|
|
MT405 |
C. elegans |
dpy-1(e1) lon-1(e185) III. Show Description
|
|
MT573 |
C. elegans |
dpy-1(e1) unc-93(e1500) III. Show Description
DpyUnc. e1500 is semi-dominant.
|
|
MT6185 |
C. elegans |
dpy-1(e1) III; unc-34(e566) V. Show Description
Mapping strain. Unc is ts.
|
|
NH3119 |
C. elegans |
F54A5.3a(ok198) I. Show Description
No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.
|
|
OP382 |
C. elegans |
unc-119(tm4063) III; wgIs382. Show Description
wgIs382 [C06E1.8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
OP50-NeoR |
Escherichia coli |
E. coli. Show Description
Bacteria. OP50 transformed with pETMCN-EK (derived from pET-28b: Ori colE1, KanR) Kan-resistant plasmid. Resistant to Kanamycin, Neomycin, G418. Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. Biosafety Level: BSL-1.
|
|
RB1460 |
C. elegans |
F45E1.7(ok1667) X. Show Description
F45E1.7 Homozygous. Outer Left Sequence: tacaccatcccaacgaatca. Outer Right Sequence: ttatgcacttcgatgcctca. Inner Left Sequence: ttttgccgagtctggagttt. Inner Right Sequence: caggattctgggaagttgga. Inner Primer PCR Length: 3331. Estimated Deletion Size: about 2600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1592 |
C. elegans |
nhr-64(ok1957) I. Show Description
C45E1.1. Homozygous. Outer Left Sequence: AAATTCGTGTCGAAAATGCC. Outer Right Sequence: GTGGACGGTGTGATCACTTG. Inner Left Sequence: GGGATAGAATTCGACCAGCA. Inner Right Sequence: ATCGTTGCATTTAAGGTGGC. Inner Primer PCR Length: 2771 bp. Deletion Size: 1348 bp. Deletion left flank: AATCACTACCTTATGAAGGTCGAATGAGCA. Deletion right flank: AAATCAATTTCGAACTCAGTTTTCAAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1729 |
C. elegans |
gcy-36(ok2208) X. Show Description
C46E1.2 Homozygous. Outer Left Sequence: gcttttcgtcgttggaactc. Outer Right Sequence: ggtgtgtacttgaagggcgt. Inner Left Sequence: cggccatagtaatggaatgg. Inner Right Sequence: cccgagttgttcttctctcg. Inner Primer PCR Length: 3041. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1781 |
C. elegans |
his-71(ok2289) X. Show Description
F45E1.6. Homozygous. Outer Left Sequence: GCAGAAAGAACTGAAACGGC. Outer Right Sequence: CCAAGTCCCACACTCGTTTT. Inner Left Sequence: TGTTCCCGTTCACAATCGTA. Inner Right Sequence: AAACTCAAAACCGGCAAATG. Inner Primer PCR Length: 2285 bp. Deletion Size: 991 bp. Deletion left flank: CCCAACGAGGTAGGCCTCAGAAGCCTCTTG. Deletion right flank: AGATGGCTGTGAGCGAGAGCGAGGCAATGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2026 |
C. elegans |
gla-3(ok2684) I. Show Description
T02E1.3. Homozygous. Outer Left Sequence: AGACCCTGAATGAATCCGTG. Outer Right Sequence: GTGGCTCCTTGAGAGTTTCG. Inner Left Sequence: TACCATATCCCACCACAGCA. Inner Right Sequence: ATCGAGCAGATTCTCGTTGC. Inner Primer PCR Length: 1125 bp. Deletion Size: 657 bp. Deletion left flank: CAGAGTGATCAAATGAGTAATGGTCATCAC. Deletion right flank: GAAAGCTCAAGTCCTGTCGTGATGTCTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RG3049 |
C. elegans |
K07E1.1(ve549[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 979 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tattttctcctgctttcagttttgatttcc ; Right flanking sequence: ccatctgtcttgtaaatagagctctcttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3270 |
C. elegans |
F52E1.2(ve770[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1067 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattttttgataattttttACAAAATGCCA ; Right flanking sequence: AGGGAGCAAGTGCATAACAAGTCGAAATAA. sgRNA #1: ATTAAAAACGCGAGTGAAGT; sgRNA #2: TGCGAGTTACATTTGTGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RW10714 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10453. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
SD1910 |
C. elegans |
glo-4(ok623) V; stIs10453. Show Description
stIs10453 [elt-2::TGF(7E1)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. glo-4(ok623) causes a a partially-penetrant Dpy phenotype.
|
|
SLE1 |
Escherichia coli |
E. coli [argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rcn14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase]. Show Description
Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.
|
|
SP1697 |
C. elegans |
dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp84 (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplications are DpyUncNcl. Maintain by picking WT. Males containing mnDp84 are not fertile.
|
|
SP17 |
C. elegans |
unc-32(e189) dpy-1(e1) III. Show Description
DpyUnc.
|
|
SP1707 |
C. elegans |
dpy-1(e1) ncl-1(e1865) unc-36(e251) III; mnDp86 [dpy-1(+) him-10(+) ncl-1(+) unc-36(+)] (III;f). Show Description
Animals with mnDp86 are WT. Animals which have lost mnDp86 are DpyUnc and Ncl.
|
|
SP1784 |
C. elegans |
dpy-1(e1) ncl-1(e1865) unc-36(e251) III; him-8(e1489) IV; mnDp90 [dpy-1(+) ncl-1(+) unc-36(+) unc-93(+)] (III;f). Show Description
Animals with mnDp90 are WT. Animals which have lost mnDp90 are DpyUnc and Ncl. Throws males. Males containing mnDp90 are fertile. mnDp90 was derived from mnDp86.
|
|
SP1882 |
C. elegans |
dpy-1(e1) ncl-1(e1865) III; unc-3(e151) osm-1(p808) X; mnDp92 [dpy-1(+) ncl-1(+) unc-3(+) osm-1(+)] (III;X;f). Show Description
Animals with mnDp92 are WT. Animals which have lost mnDp92 are DpyUncOsm and Ncl. Males containing mnDp92 are fertile. mnDp92 was derived by fusing mnDp14 and mnDp90.
|
|
SP1911 |
C. elegans |
dpy-1(e1) ncl-1(e1865) III; unc-3(e151) osm-1(p808) X; mnDp91 (III;X;f). Show Description
Animals with mnDp91 are WT. Animals which have lost mnDp91 are DpyUncOsm and Ncl. mnDp91 derived by fusing mnDp14 and mnDp90.
|
|
SP462 |
C. elegans |
dpy-1(e1) unc-36(e251) III; mnDp37[unc-32(e189)] (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc-36.
|
|
SP529 |
C. elegans |
unc-45(e286) dpy-1(e1) III. Show Description
Dpy. Unc (ts).
|
|
VC1384 |
C. elegans |
C26E1.3(gk644) V. Show Description
C26E1.3. Superficially wild type. External left primer: TGCGTGATTTACAGGTGAGC. External right primer: TCCAGGGCAATATTTTCAGC. Internal left primer: GGACGATACGTTGGGCAATA. Internal right primer: TTCTGAGATGCTGTTGCCAG. Internal WT amplicon: 2016 bp. Deletion size: 549 bp. Deletion left flank: GTGACATGTTCAACTCGAACTGTTCTATAT. Deletion right flank: CATTTGTTTCAGCGTCCCAAGCACAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2111 |
C. elegans |
rha-2(ok2639) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06E1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2639 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCCAATGTTTTTCCGAGT. External right primer: TTCCACTTCGTTCCAAAACC. Internal left primer: CGTGATTCTTGCTTCCGTTT. Internal right primer: GTTATCAAAGTTGACGCCCG. Internal WT amplicon: 1103 bp. Deletion size: 558 bp. Deletion left flank: TCTGGAAATTAGCTTTTTTATTCTATAAAT. Deletion right flank: AGAATGGCACCCGGTGGTAGAGTTTCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2326 |
C. elegans |
C06E1.8(gk1061) III. Show Description
C06E1.8. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 559 bp. Deletion left flank: ATTATTCAAAGTCCCCAATTCAAATACAGT. Deletion right flank: GTTTTCATTCTATTTCATATTTTTGTCTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2689 |
C. elegans |
ztf-30(gk1287) III. Show Description
This strain is homozygous for a deletion (gk1287) in C06E1.8, detectable by PCR using the following primers. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 1044 bp. Deletion left flank: TGTTGTTGCTGTCATTGTTGTTAGTGGCAG. Deletion right flank: AATCATTATAAAAGTAAGAACCTAATCAGA. Insertion Sequence: CAG. Validation: gk1287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC365 |
C. elegans |
+/nT1 IV; mom-2(ok591)/nT1 V. Show Description
F38E1.7, F38E1.9. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok591 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC383 |
C. elegans |
nhx-6(ok609) II. Show Description
F58E1.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC3920 |
C. elegans |
C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
ZE1 |
C. elegans |
F53B2.5(ok226) Show Description
Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.
|
|
AA199 |
C. elegans |
unc-29(e1072) I; daf-9(dh6)/+ X. Show Description
Heterozygous. Heterozygotes will segregate dauers and wild-type. Pick wild-type and check for correct segregation to maintain.
|
|
AC68 |
C. elegans |
unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs.
|
|
AD226 |
C. elegans |
egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
AD271 |
C. elegans |
spe-38(eb44) I; him-5(e1490) V; asEx78. Show Description
asEx78 [spe-38p::spe-38(cDNA)::spe-38 3'UTR + myo-3p::GFP]. Pick GFP+ to maintain. GFP+ worms are fertile; animals that have lost the array are sterile.
|
|