Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.

nIs2 [lin-11::lacZ + lin-11(+)] IV. Egl. Integrated on IV near dpy-20.

maIs113 [cki-1::GFP + dpy-20(+)]. Non-Dpy. cki-1::GFP is expressed in all arresting cells that have exited cell cycle.

nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.

wbmIs60 [pie-1p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (III:7007600). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs60 can be used to direct germline-specific gene expression from the pie-1 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific pie-1 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs61 [myo-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs61 can be used to direct muscle-specific gene expression from the myo-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs65 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs66 can be used to direct neuron-specific gene expression from the rab-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs76 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs76 can be used to direct soma-specific gene expression from the eft-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific eft-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs88 [eft-3p::3XFLAG::dpy-10::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs67]. (V:8645000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the soma-specific eft-3 promoter. wbmIs88 exhibits soma-specific dpy-10 and wrmScarlet expression driven the eft-3 promoter. Derived from parental strain WBM1143 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs89 [rab-3p::3xFLAG::dpy-10::SL2::wrmScarlet::rab-3 3'UTR, *wbmIs68] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of the neuron-specific rab-3 promoter. wbmIs68 exhibits neuron-specific dpy-10 and wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1144 by CRISPR-mediated modification of tissue-specific transgene. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.

wbmIs97 [eft-3p::tomm-20(aa1-49)::GFP::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::GFP expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::GFP downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

wbmIs98 [eft-3p::tomm-20(aa1-49)::mCherry::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::mCherry expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::mCherry downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

wbmIs83 [rab-3p::3xFlag::TIR1::rab-3 3'UTR] *wbmIs66 IV. Auxin-inducible degron (AID) and EmGFP tags inserted at the C-terminus of the endogenous raga-1 locus using CRISPR/Cas9. Neuronal-specific expression of TIR1 allows for auxin-inducible degradation of RAGA-1 in the nervous system. wbmIs66 [rab-3p::3XFLAG::dpy-10 crRNA::rab-3 3'UTR] (IV:5015000). Reference: Smith HJ, et al. PLOS Genetics 19(9): e1010938. https://doi.org/10.1371/journal.pgen.1010938. PMID: 37721956.

ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.

Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.

ddIs? [pie-1p::GFP::par-6 + unc-119(+)]. Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.

ddIs? [pie-1p::mCherry::par-6 + unc-119(+)]. Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.

ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.

Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.

Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496.

Dpy and Vab (tail abnormalities).

Heterozygotes are WT and segregate WT, Smalls which produces dead eggs, and Dpy Steriles. Throws males.

Heterozygotes are WT and segregate WT, Dpy Steriles and arrested L1 coilers. Fails to complement unc-50.

Heterozygotes are WT and segregate WT, Uncs which are sterile (>10 offspring) and Dpys. Throws males of all classes. mIn1 pka mC6.

n2515 suppresses the let-60(gf) Muv phenotype. Isolation of lin-1 causes no significant vulval defect; it is a missense mutation that changes Proline 384 to Leucine. dpy-13 is a linked marker.

Intermediate severity of lin-45 raf allele: at 20C, 76% larval lethal and 24% display an abnormal vulva (either Egl, no discernable vulva, or PVul). Medium Dpy. Received new stock 11/2002.

Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.

Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. qa6200 has maternal effect sterility and maternal effect embryonic lethality.

qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. tm1227 has maternal effect sterility and maternal effect embryonic lethality.

geIs3 [sir-2.1(+) + rol-6(su1006)] I. oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Rollers. Dpy. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73.

qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.

yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm2868 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. tm2868 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

mIn1 carries a GFP marker. Heterozygotes are GFP+ and segregate heterozygotes (wild-type GFP+), mIn1 homozygotes (Dpy GFP+) and vr6 homozygotes (GFP- and arrest as L1/L2 larvae). Maintain by picking GFP+ and checking for proper segregation of progeny. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.

hpEx2908 [myo-2p::RFP + dpy-30p::daf-2]. Transgenic worms do not dauer. Pick RFP+ animals to maintain. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.

hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.

This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.