Search Strains

More Fields
Strain Species Genotype Add
VC2986 C. elegans dpy-1(gk3073) III. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2987 C. elegans dpy-1(gk3074) III. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3029 C. elegans ran-3(ok3709)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C26D10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3709 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTTTCAATCCGAGACC. External right primer: ATTGGCGATCGAGTTTTGTC. Internal left primer: GGCAGAAACACCAACGATCT. Internal right primer: AAAAAGCCACGGAAAGTTGA. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: TCCGAAGGCGTAGTATTTTCCGTCTTCTCC. Deletion right flank: CTTCCTTCCTTCTCTACACCTTCCGCGGGA. Insertion Sequence: CTTTTTTTCCTTTTTTTTCCGTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3049 C. elegans hel-1(ok3698)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C26D10.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3698 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACCAAGTTCTGGCCATCT. External right primer: TTCCATTCTCCTTCCACCTG. Internal left primer: GGCGGAGAACATCATCACTT. Internal right primer: TTTCGGATCGTTTCGCTACT. Internal WT amplicon: 1141 bp. Deletion size: 721 bp. Deletion left flank: TGTCGCACTCGTCCAGGACGAAGTACTTGA. Deletion right flank: GAAATTTAGTAAATAACCTCACAAAAACAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC308 C. elegans rab-7(ok511)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
W03C9.3. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and non-GFP ok511 homozygotes (Dpy animals that lay dead eggs). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3119 C. elegans +/mT1 II; C07A9.4(ok3733)/mT1 [dpy-10(e128)] III. Show Description
C07A9.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3733 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTGCGATGTTTGAAAACGAA. External right primer: TTTCGGGTTGCCGAATAATA. Internal left primer: TCTTCTATTGGCAATGCAACC. Internal right primer: CTGTGAAGGTGGTGGTTACG. Internal WT amplicon: 1278 bp. Deletion size: 537 bp. Deletion left flank: CAAAATGCCAAAAATGCTAGAGCAACAAGA. Deletion right flank: ATAACACCAACATGTAGATGACCCCGGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC312 C. elegans +/mT1 II; sel-8(ok387)/mT1 [dpy-10(e128)] III. Show Description
C32A3.1. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok387 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3139 C. elegans Y53C12B.1(ok1245)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Y53C12B.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1245 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGCTGCTAGTGGCCATGTTT. External right primer: GAAATGGGTGGGCACTTAAA. Internal left primer: GCTAACATCTTGCTTTGCCC. Internal right primer: CGCGTAGAATTAAACGGGAA. Internal WT amplicon: 3125 bp. Deletion size: 1458 bp. Deletion left flank: CAGTATGCGCATCAATGGAACATTCACAAT. Deletion right flank: TTTCTTGAGTTTCTGTTTCATGAATACTCA. Insertion Sequence: TTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3151 C. elegans cpf-1(ok1220)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F28C6.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1220 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTCCGAGTGAACTGGCT. External right primer: AGCACACATGCAGGTTGAAA. Internal left primer: CCATTTGAAGCAGCCAAGAT. Internal right primer: TACGATTTGAGGGGAGATCG. Internal WT amplicon: 2198 bp. Deletion size: 1785 bp. Deletion left flank: CTTTCTGTCGGAATTGCGAGCATCCCACGA. Deletion right flank: TTAAACTTATATTAAAGGCGCATGCCGTTT. Insertion Sequence: ACTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3153 C. elegans sco-1(ok3770)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C01F1.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3770 homozygotes (mid- to late-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCGATGATGTGCGAATTTGT. External right primer: CAATCGAACGCCTTGAAAAT. Internal left primer: CAAATCCATGATTTTCACTCCA. Internal right primer: AAGCTGAGCAATGGTTTTCTTT. Internal WT amplicon: 1241 bp. Deletion size: 653 bp. Deletion left flank: GGACGCTGGCATCAGCCGCACGGTTTTCAG. Deletion right flank: GGAACCACAGAGCAAGTTAATAAAGTTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC316 C. elegans +/mT1 II; npp-10(ok467)/mT1 [dpy-10(e128)] III. Show Description
ZK328.5b. Heterozygotes are sickly WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok467 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3166 C. elegans +/mT1 II; arx-3(ok1122)/mT1 [dpy-10(e128)] III. Show Description
Y79H2A.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1122 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGGAAATCGTTTTGGCAT. External right primer: TTAAAACTCCGGCCAATCAG. Internal left primer: AACCACTTTTCCTCGTCCCT. Internal right primer: TTTTCGTGGCAAATTCCTTC. Internal WT amplicon: 2630 bp. Deletion size: 1688 bp. Deletion left flank: TTTTCCACCGATTTTTAATGTTTTCGATGT. Deletion right flank: GTTTTTGCGGTTAAGCCGGTCGAAATTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3182 C. elegans kbp-3(ok3713)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F26H11.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3713 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATCGTCTTCTTCGTCGTCGT. External right primer: ATCGGCTTTTCTCAAGTGGA. Internal left primer: TCGTCTTCCTCATCATCATCC. Internal right primer: TGCTAATTTTGCTGTCGCAT. Internal WT amplicon: 1133 bp. Deletion size: 434 bp. Deletion left flank: CAAAATTTTTACCGCTCTTCAGTGCCGCCC. Deletion right flank: ACATCTAAACAATTTCCTTGCAAATTTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3188 C. elegans C17G10.2(gk3077)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C17G10.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3077 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGAATGCAAAACCTGAGAACAA. External right primer: TACAGCTGGATTTTCAACTGGAT. Internal left primer: ATACACCCGCTTTCCACAAG. Internal right primer: CCTCCAGCTTTCGATTTACG. Internal WT amplicon: 2029 bp. Deletion size: 368 bp. Deletion left flank: TTCGGTTACTCTTTGTTTTATATTTATTTT. Deletion right flank: TATTCAGTCTATGAAATACGATAAAGAAGA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC319 C. elegans +/mT1 II; tbx-2(ok529)/mT1 [dpy-10(e128)] III. Show Description
F21H11.3. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok529 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3192 C. elegans Y50D7A.4(gk3089)/sC1 [dpy-1(s2170)] III. Show Description
Y50D7A.4. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3089 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTATCCGAATTTTCTGCGG. External right primer: ATTTTCAACGGAATTCGACG. Internal left primer: GAAAATTTTGCATTTTCAAGGC. Internal right primer: TCCGCGATTTTTATAGCATTTT. Internal WT amplicon: 940 bp. Deletion size: 647 bp. Deletion left flank: TTTTGTCAAGCCTCAAATCCCACAATTTTG. Deletion right flank: ATAAATGAGCCAAAATTCGTCAAATTCTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3220 C. elegans pfs-2(ok3744)/mT1 II; +/mT1[dpy-10(e128)] III. Show Description
R06A4.9. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3744 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTTGTGTCTGGTGGTGGA. External right primer: GATGATTGTTGTTGTTGCGG. Internal left primer: TGGTTCAATAGTCTACTGGATGGT. Internal right primer: AACGAAAAACCAACCCTTCC. Internal WT amplicon: 1161 bp. Deletion size: 688 bp. Deletion left flank: GGCGACACTGTTGAAGACATTTTTGGATTG. Deletion right flank: CATCTCAGCAAGGACCTCCTCCACGACAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3222 C. elegans C30B5.4(gk3082)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C30B5.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3082 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGGTGTGTGCATAAGGA. External right primer: TTGATTGAATTGGCGATGAA. Internal left primer: GAGAGCTTCGGAAGACATGG. Internal right primer: TCCAGGTTCCCTGAAACAAG. Internal WT amplicon: 1567 bp. Deletion size: 390 bp. Deletion left flank: AAAATTTGAAAAAGGCTTTATATTAATGTT. Deletion right flank: TCGGATTCATGTTTTACTGCAAAATGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3223 C. elegans +/mT1 II; atf-7(gk3083)/mT1 [dpy-10(e128)] III. Show Description
C07G2.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3083 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 836 bp. Deletion left flank: CCGTTTTGTGGACGTCCAACTGGATTTCCA. Deletion right flank: TTGGCTTCCAAAGCTTCAAGAGATTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3224 C. elegans +/mT1 II; set-16(ok3661)/mT1 [dpy-10(e128)] III. Show Description
T12D8.1. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3661 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAACAGTTCCGTAACGCTCA. External right primer: TTCTGATGGGGCTATTGGAG. Internal left primer: GACGAGATCACGGATCCAAT. Internal right primer: GTTTTTGCACTGGCTGGAAT. Internal WT amplicon: 1224 bp. Deletion size: 706 bp. Deletion left flank: GCTTCCACAGGTCGACGTCGATCCGCCGAA. Deletion right flank: AAAGATGAGGTCGCCTGGAGTATGGAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3228 C. elegans R53.6(gk3079)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R53.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3079 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCGTGAACGTTCTTGTT. External right primer: CAAAGAAAGCCAAGGTCGAG. Internal left primer: AAAATGTGTGCAGTTTTCAACG. Internal right primer: AACAACGACATCGTGTTCACTC. Internal WT amplicon: 1340 bp. Deletion size: 565 bp. Deletion left flank: TTATATCCTATTTTCTGCTTTAAATTTGAG. Deletion right flank: AATTTGAAACGTCAGATGGAACTCAAGTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3288 C. elegans myrf-1(gk3366)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3317 C. elegans +/II; gly-5(gk3278)/mT1 [dpy-10(e128)] III. Show Description
Apparent homozygous lethal deletion chromosome (gk3278 in Y39E4B.12) balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAAAGGCAAAATACGACAAGG. External right primer: AATCGCGAAAAATTTCCAGTAA. Internal left primer: CAAAAATGTTGTCGATTTACGAAG. Internal right primer: CTTTTCTTACCAAGCATCGAATTT. Internal WT amplicon: 1049 bp. Deletion size: 581 bp. Deletion left flank: TCTGTACAAAAAAGCATTTTTTCTGCAAAA. Deletion right flank: AATGGAAGGTAAAAATTAAATTTTCGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3363 C. elegans gei-4(gk3508)/sC1 [dpy-1(s2170)] III. Show Description
W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3508 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. WT internal amplicon: 2021 bp. Deletion size: approximately 1100 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3364 C. elegans F37B12.3(gk3365)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3365 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTTGCGTCAAAGTACGGT. External right primer: CCTATACACCTCTCATGCCTCC. Internal left primer: GGGTACCGTATTTTAGCGCA. Internal right primer: CCTGACGAATTGCCATCTTT. Internal WT amplicon: 2539 bp. Deletion size: 983 bp. Deletion left flank: GTGACAAGTTAAAGCGAATGGACCGAACAA. Deletion right flank: TGGAATTTAATAAAAATGTGTGGCTGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC337 C. elegans gcs-1(ok436)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F37B12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok436 homozygotes (approximately L2 arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3391 C. elegans R06F6.8(ok1318)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R06F6.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1318 homozygotes (sterile, lays unfertilized oocytes and very few fertilized eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATAAACGTCATTTCCT. External right primer: AACGTTTTTGCGTTCCAAAT. Internal left primer: TTGATTCCTTTTGCACCACA. Internal right primer: CTTCCGAAGCATGAAAAGGA. Internal WT amplicon: 3207 bp. Deletion size: 1673 bp. Deletion left flank: CAACCGACGCATATCGACTGTCAAGTCTCT. Deletion right flank: TTAATTCTCCACGTGTTTCTTTGAAATTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC341 C. elegans hel-1(gk191)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
C26D10.2. Heterozygotes are WT and segregate WT, paralyzed Dpy mnC1 homozygotes and gk191 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3442 C. elegans B0495.2(gk1202)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.2. Homozygous maternal-effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1202 homozygotes (viable F1s produce few F2s that arrest as early or mid-stage larvae). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTATGAGCGACCACTTGGG. External right primer: CATTGAGGCAATTGAGAGCA. Internal left primer: GGACGACAGGAAAGATCTGG. Internal right primer: GGGTTTCACTTGCTCTGGTC. Internal WT amplicon: 2049 bp. Deletion size: 712 bp. Deletion left flank: GACAAATCGCCACACAAAAAGTCAAAACAT. Deletion right flank: GGAGAAAGAGAAAGAAGGATTTCCAATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3478 C. elegans +/mT1 II; spcs-2(gk3387)/mT1[dpy-10(e128)] III. Show Description
Homozygous lethal or sterile deletion balanced by translocation marked with dpy-10(e128). Heterozygotes are fertile WT and segregate fertile WT, gk3387 homozygotes (sterile adults that tend to explode at vulva), dead eggs (aneuploids) and sterile Dpy-10 mT1 homozygotes. Pick fertile WT to maintain. Reasonably well balanced but not perfect.
VC3498 C. elegans gei-4(gk3388)/sC1[dpy-1(s2170)] III. Show Description
W07B3.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk3388 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTGGATAATCATGCCAGAAGTG. External right primer: ATCGAGCAGAATTTGTCCATTT. Internal left primer: ACACCTGAATCTGCTGCTGTT. Internal right primer: ACGAATTGAATGAAATCACGC. Internal WT amplicon: 2021 bp. Deletion size: 296 bp. Deletion left flank: ATCCAGTGCTTCTCCGTTGATACGGCCTAT. Deletion right flank: CAAGTTTGGTATGGTAAATATTTAGCAGAC. Insertion Sequence: GTTTGGTATGGTAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC354 C. elegans acr-7(ok605)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T09A5.3. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok605 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3566 C. elegans clpf-1(ok3753)/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3575 C. elegans sma-2(ok3109)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC36 C. elegans unc-5(gk29) pmk-2(gk21)/nT1 IV; +/nT1 V. Show Description
F42G8.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk21 hermaphrodites (L1 arrest). gk21 appears to be linked to an uncharacterized unc-5 lesion: complementation tests with unc-5/+; dpy-11/+ males produced viable Unc-5 male and hermaphrodite progeny. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC362 C. elegans unc-5(e53) IV/nT1 [qIs51] (IV;V); dpy-11(e224) V/nT1 [qIs51] (IV;V). Show Description
Morphological markers unc-5 and dpy-11 balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploid progeny, and GFP- unc-5; dpy-11 homozygotes. nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC363 C. elegans nhx-2(ok553)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.4. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok553 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC368 C. elegans puf-5(ok464)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54C9.8. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok464 homozygotes (probable embryonic arrest). Some heterozygotes appear to be sterile and even those with eggs seem to grow a bit slowly. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3830 C. elegans F13H8.2(gk3816)/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain.
VC384 C. elegans ooc-5(ok604)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44G4.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok604 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC389 C. elegans frh-1(ok610)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59G1.7, F59G1.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok610 homozygotes (viable GFP- adult, sometimes slow-growing with various occasional body defects). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC391 C. elegans heh-1(ok603)/sC1 [dpy-1(s2170)] III. Show Description
R148.6. Heterozygotes are WT, and segregate WT, Dpy sC1 homozygotes, and ok603 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3983 C. elegans mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.
VC407 C. elegans rrf-3(ok629)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10B5.7. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok629 homozygotes (usually sterile adults, occasionally produce progeny). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4098 C. elegans hrpk-1(gk5045[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous sterile deletion balanced by tmC18. Heterozygotes are wild-type with pharyngeal GFP+RFP+, and segregate GFP+RFP+ heterozygotes, GFP+ gk5045 homozygotes (most commonly sterile, but occasional animals will lay eggs that hatch, and a population of homozygotes can be maintained), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+RFP+ to maintain. Deletion of 1976 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAAATGATGATCAAAGTGGGAGCCGCTA ; Right flanking sequence: GGTGGATCTGTCTAGGTTCTGGTGTTCGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4099 C. elegans C29E4.12(gk5046[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal deletion balanced by qC1. Deletion of 304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTACATTTTCAAAATTAAAGTATGGCCT ; Right flanking sequence: TGGCGAGAAGAGTGTTGAAGAGGCTGCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4100 C. elegans lron-9(gk5062[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC18 [dpy-5(tmIs1236)] I. Show Description
Homozygous lethal deletion balanced by tmC18. Heterozygotes are WT with pharyngeal GFP, and segregate GFP heterozygotes, GFP gk5062 homozygotes (arrest stage undetermined), and tmC18 homozygotes (Dpy-5 with myo-2 mCherry). Pick fertile wild-type GFP+ to maintain. Deletion of 2039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTGTCGTATTTTTGTTACAGTACCTACG ; Right flanking sequence: GGTGGTTGGAAGATTCCATCAGCACGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC411 C. elegans +/mT1 II; kin-19(ok602)/mT1 [dpy-10(e128)] III. Show Description
C03C10.1. Heterozygotes are WT and segregate WT, arrested mT1 aneuploid progeny, sterile Dpy-10 mT1 homozygotes, and homozygous ok602 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC42 C. elegans qua-1(gk32)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T05C12.10. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk32 homozygotes (early larval arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4237 C. elegans nifk-1(gk5029[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Homozygous lethal or sterile deletion balanced by qC1. Deletion of 984 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: CAGATCTCAGACACAATGGTTGCCCAGAAT; Right flanking sequence: CCCGTCCAGCTGCTGTCGAAAAGAAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.