More Fields
Strain Species Genotype
SV84 C. elegans cdk-1(he24)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he24).
SV85 C. elegans cdk-1(he25)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
he25 is temperature sensitive. At 25C: Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. At 15C: Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes) and cdk-1 homozygotes which are slightly smaller than WT, complete nearly all cell divisions, are sterile and have less germ cells than N2 (sperm are present but no oocytes). Previously called ncc-1(he25).
SV92 C. elegans cdk-1(he26)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he26).
SV93 C. elegans cdk-1(he5)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he5).
TB1 C. elegans ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I. Show Description
ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.
TG9 C. elegans dpy-13(e184) rad-51(lg8701) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, and dead eggs.
TH11 C. elegans unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
TH37 C. elegans dpy-11(e224) unc-23(e25) V. Show Description
Dpy. Unc.
TJ1049 C. elegans dpy-10(e128) emb-27(g48) II. Show Description
Temperature sensitive. Dpy.
TN142 C. elegans dpy-20(cn142) IV. Show Description
Recessive Dpy. Rounded head. Reduced brood size
TN322 C. elegans dpy-20(cn322) IV. Show Description
Recessive Dpy. Rounded head.
TN326 C. elegans dpy-20(cn326) IV. Show Description
Recessive Dpy. Rounded head. Reduced brood size.
TN64 C. elegans dpy-10(cn64) II. Show Description
Temperature sensitive. Dpy when grown at 15C. DpyRoller when grown at 25C. Heterozygotes are Rollers at any temperature.
TU2589 C. elegans dpy-20(e1282) IV; uIs25 X. Show Description
uIs25 [mec-18::GFP + dpy-20(+)].
TU3403 C. elegans ccIs4251 I; sid-1(qt2) V; uIs71. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
TY1353 C. elegans yDf10 unc-32(e189)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.
TY148 C. elegans dpy-28(y1) III. Show Description
Temperature sensitive. 20% viable at 20C. 80% viable at 15C. XX animals are Dpy. XO animals are nearly WT.
TY156 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). Show Description
Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT.
TY1702 C. elegans unc-42(e270) yDf12 V/nT1 [unc-?(n754) let-?] (IV;V); dpy-6(e14) X. Show Description
Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.
TY1936 C. elegans dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.
TY2071 C. elegans him-8(e1489) IV; dpy-3(e27) unc-2(e55) X; yDp16 (X;f). Show Description
non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.
TY2139 C. elegans mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf13 unc-1(e1598n1201) dpy-3(e27) X. Show Description
Heterozygotes are WT hermphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; yDf13 unc-1 dpy-3), WT males and Dpy males.
TY2175 C. elegans mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17/unc-1(e1598n1201) dpy-3(e27) X. Show Description
WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.
TY2782 C. elegans fox-1(y303) dpy-6(e14) X. Show Description
TY2788 C. elegans unc-4(e120) II; yDf19/yDf20 X. Show Description
yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.
TY3579 C. elegans sea-1(y356) II. Show Description
Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.
TY3837 C. elegans dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
TY3936 C. elegans dpy-21(e428) V. Show Description
Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.
TY415 C. elegans unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. Show Description
WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.
TY418 C. elegans dpy-21(y47) V. Show Description
Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
TY4236 C. elegans him-8(e1489) IV; mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.
TY4381 C. elegans dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
TY4986 C. elegans htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
TY5434 C. elegans syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.
TY574 C. elegans dpy-21(y59) V. Show Description
Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y59) is a nonsense mutation predicted to terminate translation at codon 417, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
TY832 C. elegans yDf4/dpy-11(e224) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
TZ101 C. elegans pxf-1(pk1331) dpy-20(e1362) IV; pkEx10. Show Description
pkEx10 [T14G10 + dpy-20(+)]. Maintain by picking WT.
UDN100022 C. elegans rab-5(udn11)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658
UDN100028 C. elegans rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
UDN100035 C. elegans rab-5(udn17)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [Q78R] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78R] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent KpnI site added in Q78R for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100037 C. elegans rab-5(udn15)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UDN100083 C. elegans unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping.
UDN100103 C. elegans rab-5(udn49)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Homozygous lethal rab-5 [A29P] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29P] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent DdeI site added in A29P for genotyping ease. Reference: Huang et al. 2022. PMID: 35121658
UDN100126 C. elegans rab-5(udn64)/tmC18 [dpy-5(tmIs1236)] I; udnSi38 II. Show Description
udnSi38 [rab5p::rab-5] II. Maintain at 20 degrees. rab-5 [D135N] variant edit #2 with a single copy of wild-type rab-5 integrated into chromosome II at ttTi5605 site (II: 0.77). Homozygous lethal rab-5 [D135N] mutation balanced by tmC18. Balancer marked with myo-2p::mCherry. Heterozygotes are WT with pharyngeal mCherry fluorescence, and segregate mCherry + heterozygotes, non-mCherry rab-5 [D135N] homozygotes (L1 lethal), and Dpy mCherry+ tmC18 homozygotes. Pick fertile wild-type mCherry+ to maintain. [D135N]/ [D135N]; udnSi38/udnSi38 double homozygotes are lethal. Reference: Huang et al. 2022. PMID: 35121658
UDN100145 C. elegans rab-5(udn47)/tmC18 [dpy-5(tmIs1200)] I. Show Description
rab-5 [A29A]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [A29A] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn47 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [A29A] homozygotes from taking over the population and losing the balancer! Silent DdeI site added in A29A allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658
UDN100169 C. elegans unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer.
VC10002 C. elegans bli-2(e768) F10E7.2&spon-1&F10E7.11(gk460) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10005 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10007 C. elegans bli-2(e768) C06A8.1(gk465) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1012 C. elegans +/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III. Show Description
C28H8.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1483 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807