SSM596 |
C. elegans |
rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. Show Description
Crispr/Cas9-engineered indel in the 5 region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.
|
|
ST13 |
C. elegans |
klf-3(nc13)/dpy-10(e128) unc-53(n569) II; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1.
|
|
ST21 |
C. elegans |
ncIs2 II; mup-4(nc21)/dpy-17(e164) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development or as embryos. Not well balanced. Neurons visualized with NcIs2.
|
|
ST22 |
C. elegans |
ncIs2 II; mup-4(nc22)/dpy-17(e164) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development or as embryos. Not well balanced. Neurons visualized with NcIs2.
|
|
ST29 |
C. elegans |
ven-2(nc29)/mnC1 [dpy-10(e128) unc-52(e444)] II; ncIs3 III. Show Description
ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development.
|
|
ST30 |
C. elegans |
spon-1(nc30) ncIs2/dpy-10(e128) unc-53(n569) II. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.
|
|
ST35 |
C. elegans |
ncIs2 II; mup-4(nc35)/dpy-17(e164) unc-32(e189) III. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest as embyros or in larval development. Not well balanced. Neurons visualized with ncIs2.
|
|
SU351 |
C. elegans |
mig-5(rh94)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.
|
|
SU352 |
C. elegans |
mig-5(rh147)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with GFP in pharynx. Segregate Dpy and GFP+. mig-5 homozygotes are non-GFP and show a weakly penetrant gonad defect and a fully penetrant QL.d migration defect.
|
|
SV122 |
C. elegans |
lin-5(n3070)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3070 is a strong loss-of-function or null allele. Molecular lesion: P to S at position 24 as well as an amber mutation terminating translation after amino acid 52. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
|
|
SV123 |
C. elegans |
lin-5(n3066)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. n3066 is a strong loss-of-function or null allele. Molecular lesion: ochre mutation terminating translation at amino acid 538. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
|
|
SV13 |
C. elegans |
lin-5(e1348)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. Molecular lesion: amber mutation terminating translation at amino acid 159. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
|
|
SV31 |
C. elegans |
cdk-1(n3064)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(n3064).
|
|
SV314 |
C. elegans |
rol-1(e91) cyd-1(he112)/mnC1 [dpy-10(e28) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.
|
|
SV329 |
C. elegans |
rol-1(e91) cyd-1(he116)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and rol-1 cyd-1 homozygotes which are thin, sterile, uncoordinated animals. rol-1 is largely suppressed by cyd-1. No postembryoinc cell divisions take place in cyd-1.
|
|
SV46 |
C. elegans |
lin-5(e1457)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Stu and DpyUncs. e1457 is a strong loss-of-function or null allele. Molecular lesion: G to E at position 40. DNA replication continues in the absence of mitosis. Mutants enter mitotis at the normal time and form bipolar spindles, but fail chromosome alignment at the metaphase plate, sister chromatid separation and cytokinesis.
|
|
SV84 |
C. elegans |
cdk-1(he24)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he24).
|
|
SV85 |
C. elegans |
cdk-1(he25)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
he25 is temperature sensitive. At 25C: Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. At 15C: Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes) and cdk-1 homozygotes which are slightly smaller than WT, complete nearly all cell divisions, are sterile and have less germ cells than N2 (sperm are present but no oocytes). Previously called ncc-1(he25).
|
|
SV92 |
C. elegans |
cdk-1(he26)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he26).
|
|
SV93 |
C. elegans |
cdk-1(he5)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles (qC1 homozygotes) and Sterile Uncs which have a head region that is broader than the tail region and have no postembryonic cell divisions. Previously called ncc-1(he5).
|
|
TB1 |
C. elegans |
ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I. Show Description
ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.
|
|
TG9 |
C. elegans |
dpy-13(e184) rad-51(lg8701) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, and dead eggs.
|
|
TH11 |
C. elegans |
unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
|
|
TH37 |
C. elegans |
dpy-11(e224) unc-23(e25) V. Show Description
Dpy. Unc.
|
|
TJ1049 |
C. elegans |
dpy-10(e128) emb-27(g48) II. Show Description
Temperature sensitive. Dpy.
|
|
TN142 |
C. elegans |
dpy-20(cn142) IV. Show Description
Recessive Dpy. Rounded head. Reduced brood size
|
|
TN322 |
C. elegans |
dpy-20(cn322) IV. Show Description
Recessive Dpy. Rounded head.
|
|
TN326 |
C. elegans |
dpy-20(cn326) IV. Show Description
Recessive Dpy. Rounded head. Reduced brood size.
|
|
TN64 |
C. elegans |
dpy-10(cn64) II. Show Description
Temperature sensitive. Dpy when grown at 15C. DpyRoller when grown at 25C. Heterozygotes are Rollers at any temperature.
|
|
TU2589 |
C. elegans |
dpy-20(e1282) IV; uIs25 X. Show Description
uIs25 [mec-18::GFP + dpy-20(+)].
|
|
TU3403 |
C. elegans |
ccIs4251 I; sid-1(qt2) V; uIs71. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
TY1353 |
C. elegans |
yDf10 unc-32(e189)/unc-93(e1500) dpy-17(e164) III. Show Description
Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.
|
|
TY148 |
C. elegans |
dpy-28(y1) III. Show Description
Temperature sensitive. 20% viable at 20C. 80% viable at 15C. XX animals are Dpy. XO animals are nearly WT.
|
|
TY156 |
C. elegans |
unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). Show Description
Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT.
|
|
TY1702 |
C. elegans |
unc-42(e270) yDf12 V/nT1 [unc-?(n754) let-?] (IV;V); dpy-6(e14) X. Show Description
Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.
|
|
TY1936 |
C. elegans |
dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.
|
|
TY2071 |
C. elegans |
him-8(e1489) IV; dpy-3(e27) unc-2(e55) X; yDp16 (X;f). Show Description
non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.
|
|
TY2139 |
C. elegans |
mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf13 unc-1(e1598n1201) dpy-3(e27) X. Show Description
Heterozygotes are WT hermphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; yDf13 unc-1 dpy-3), WT males and Dpy males.
|
|
TY2175 |
C. elegans |
mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17/unc-1(e1598n1201) dpy-3(e27) X. Show Description
WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.
|
|
TY2782 |
C. elegans |
fox-1(y303) dpy-6(e14) X. Show Description
|
|
TY2788 |
C. elegans |
unc-4(e120) II; yDf19/yDf20 X. Show Description
yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.
|
|
TY3579 |
C. elegans |
sea-1(y356) II. Show Description
Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.
|
|
TY3837 |
C. elegans |
dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|
TY3936 |
C. elegans |
dpy-21(e428) V. Show Description
Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.
|
|
TY415 |
C. elegans |
unc-32(e189) dpy-28(s939) III/eT1 III; +/eT1 V. Show Description
WT strain which segregates WT, Unc-36, DpyUnc and dead eggs. DpyUncs give 6-10% viable progeny at 20C and less than 1% at 15C. Maintain by picking WT.
|
|
TY418 |
C. elegans |
dpy-21(y47) V. Show Description
Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
|
|
TY4236 |
C. elegans |
him-8(e1489) IV; mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.
|
|
TY4381 |
C. elegans |
dpy-28(s939)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP s939 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|
TY4986 |
C. elegans |
htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
|
|
TY5434 |
C. elegans |
syIs44 V. Show Description
syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.
|
|