RG5050 |
C. elegans |
+/mT1 [umnIs52] II; C35D10.5(gk5552[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5552 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4480 and CGC66. gk5552 is a 1321 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAACCGAAAAATGTTCTCGTTGCTCC; Right flanking sequence: ATTGTTTATACGCGTGTTTCTCTCCACTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG5053 |
C. elegans |
+/mT1 [umnIs52] II; C36A4.4(gk5562[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5562 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4490 and CGC66. gk5562 is a 1777 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAAGACGTCGAAAATAAACTGCTCCAGCT; Right flanking sequence: GGTGGAAAACAATTCAAAAAGTGATAATAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG5054 |
C. elegans |
+/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG5056 |
C. elegans |
+/mT1 [umnIs52] II; idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG5059 |
C. elegans |
'+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG5060 |
C. elegans |
ZK622.4(hd7010[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1[dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mIn1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate2 (hd7010 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Derived from parental strains VH7029 and CGC53. hd7010 is a 180 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking sequence: ATGGATCCATGTTTCATAAAGGATGTTTTA; Right flanking sequence: ATCAAATCTTCTTTTCTCGCCAAAAACGAA. sgRNA #1: AATGTTGGATTTGCGGAACC; sgRNA #2: CGATGTGGAATTGGATCATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG93 |
C. elegans |
lin-29(ve5) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Egls which have a protruding vulva, and DpyUncs. Maintain by picking WT. lin-29 suppresses rol-1 phenotype (rol-1 is an adult specific Roller and lin-29 animals never molt to adult cuticle).
|
|
RL104 |
C. elegans |
ifet-1(it149) dpy-17(e164)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT and sterile Dpys. Referenced in Li, W. et al. J Cell Bio 187(1):33-42 (2009).
|
|
RL67 |
C. elegans |
lon-1(e185) let-711(it150) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.
|
|
RSL108 |
C. elegans |
rpl-13(ftw73[rpl-13::SL2::GFP::dpy-10]) I. Show Description
rpl-13(ftw73[rpl-13::SL2::GFP::dpy-10]) I. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible thoughout body by dissection fluorescence microscopy. D10 (dpy-10) CRISPR/Cas9 entry site is located downstream of the GFP coding region. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
RSL111 |
C. elegans |
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Show Description
rab-3(ftw74[rab-3::SL2::LoxP::GFP::dpy-10::LoxP(inv)]) II. Endogenous locus co-expresses GFP by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. dpy-10 CRISPR/Cas9 entry site is located downstream of the GFP coding region. Inverted LoxP sites flank the GFP::dpy-10 insert. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
RSL123 |
C. elegans |
dpy-10(cn64) rab-3(ftw79) II. Show Description
rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.
|
|
RSL128 |
C.elegans |
dpy-10 (cn64) II; mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X. Show Description
Dumpy roller. Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.
|
|
RV120 |
C. elegans |
spe-44(ok1400) dpy-20(e1282)/let-92(s677) unc-22(s7) IV. Show Description
Pick wild-type to maintain.
|
|
RW10166 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10157. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10157 [dpy-7::H1-wCherry + unc-119(+)].
|
|
RW11121 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10925. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10925 [dpy-31::H1-wCherry + unc-119(+)].
|
|
RW11530 |
C. elegans |
unc-119(tm4063) III; stIs11530. Show Description
stIs11530 [dpy-31::H1-wCherry + unc-119(+)].
|
|
RW11597 |
C. elegans |
unc-119(tm4063) III; stIs11597. Show Description
stIs11597 [dpy-7::H1-wCherry + unc-119(+)].
|
|
RW1383 |
C. elegans |
unc-38(x20) pat-10(st568)/unc-38(x20) dpy-5(e61) I. Show Description
Heterozygotes are Unc non-Dpy and segregate Unc non-Dpy, DpyUnc and PATs. st568 is a recessive lethal causing a PAT phenotype (paralyzed embryoes, arrested elongation at 2-fold length).
|
|
RW1536 |
C. elegans |
unc-79(e1068) pat-2(st567)/dpy-17(e164) III. Show Description
Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.
|
|
RW2070 |
C. elegans |
dpy-18(e364) III; sup-7(st5) X. Show Description
Dominant suppressor. Dpy suppressed between 22.5C and 24C. Does not grow at 20C or 25C. Must maintain between 22C and 24C!! Even at these temperatures steriles are frequent.
|
|
RW3518 |
C. elegans |
pat-11(st541)/dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, Dpys and embryos which arrest at the 2-fold stage.
|
|
RW3539 |
C. elegans |
emb-9(st545)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.
|
|
RW3568 |
C. elegans |
pat-6(st561)/dpy-9(e12) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and Pats. Maintain by picking WT and checking for correct segregation of progeny.
|
|
RW3570 |
C. elegans |
unc-112(st562)/dpy-11(e224) unc-23(e25) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Pats. Maintain by picking WT and checking for correction segregation of progeny.
|
|
RW3600 |
C. elegans |
pat-3(st564)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and PATs. st564 is a recessive lethal which causes a "severe" PAT phenotype. Strain is well balanced.
|
|
RW3625 |
C. elegans |
let-805(st456)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segreate WT, Dpy Steriles, and lethals: arrested elongation at 2 fold; body wall muscle cells detach at embryonic stage when the muscle cells begin to contract - therefore, little embryonic movement is observed.
|
|
SA25 |
C. elegans |
daz-1(tj3)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT (GFP+) and segregate WT (GFP+), Dpys (GFP+) and Steriles.
|
|
SA29 |
C. elegans |
kel-1(pe201)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and L2 larva. kel-1(pe201) homozygotes arrest development at early L2. pe201 deletes a 3.6 kb region including most of the kel-1 ORFs.
|
|
SA4 |
C. elegans |
cdl-1(w37)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs (homozygous cdl-1(w37)), and DpyUnc. w37 carries a 4.7kb deletion that removed the entire cdl-1 ORF and part of the neighboring ORF (T19E10.1), with a small insetion of about 60 bp.
|
|
SD1333 |
C. elegans |
ccIs4251 I; stIs10047. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10047 [unc-14p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1340 |
C. elegans |
ccIs4251 I; stIs10035. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10035 [eft-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1345 |
C. elegans |
ccIs4251 I; stIs10077. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10077 [pha-4p(I2L)::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1346 |
C. elegans |
ccIs4251 I; stIs10088. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10088 [hlh-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1347 |
C. elegans |
ccIs4251 I; stIs10079. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).
|
|
SD1395 |
C. elegans |
ccIs4251 I; stIs10115. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10115 [egl-5p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1408 |
C. elegans |
ccIs4251 I; gaIs218. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs218 [Y57A10C.6p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1421 |
C. elegans |
ccIs4251 I; gaIs222. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs222 [C54D10.3p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1432 |
C. elegans |
ccIs4251 I; gaIs220. Show Description
gaIs220 [col-93p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).
|
|
SD1433 |
C. elegans |
ccIs4251 I; stIs10596. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10596 [ceh-41p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1439 |
C. elegans |
ccIs4251 I; gaIs234. Show Description
gaIs234 [jkk-1p::his-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).
|
|
SD1453 |
C. elegans |
ccIs4251 I; gaIs245. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs245 [col-34p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1454 |
C. elegans |
ccIs4251 I; stIs10117. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10117 [hsp-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
|
|
SD1462 |
C. elegans |
ccIs4251 I; gaIs209. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs209 [sod-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1468 |
C. elegans |
ccIs4251 I; gaIs239. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs239 [trap-2p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
|
|
SD1471 |
C. elegans |
ccIs4251 I; gaIs232. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs232 [csq-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|
SD1477 |
C. elegans |
ccIs4251 I; gaIs235. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs235 [csq-1p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
|
|
SD1482 |
C. elegans |
ccIs4251 I; gaIs250. Show Description
gaIs250 [M02D8.1p::HIS-24::mCherry + unc-119(+)]. ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Published in Liu, X., et al., Cell, 2009. 139(6).
|
|
SD1485 |
C. elegans |
ccIs4251 I; gaIs211. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs211 [vha-12p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
|
|
SD1505 |
C. elegans |
ccIs4251 I; oxIs305 II. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. oxIs305 [dpy-30p::mCherry::HIS-24::unc-54 3'utr + Cbr-unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|