More Fields
Strain Species Genotype
NM4337 C. elegans rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
NM4431 C. elegans rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
NP1360 C. elegans arIs37 I; cup-14(cd31) II. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.
NP717 C.elegans arIs37 I; unc-119(ed3) III; cdls32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. A diphtheria toxin A fragment DT-A (E148D) is expressed under a coelomocyte-specific promoter leading to the absence of coelomocytes. Worms are slightly uncoordinated, slightly dumpy and slow growing. References: Fares H & Greenwald I. Genetics. 2001 Sep;159(1):133-45. doi: 10.1093/genetics/159.1.133. PMID: 11560892. Schwartz MS, et al. PLoS One. 2010 Mar 5;5(3):e9564. doi: 10.1371/journal.pone.0009564. PMID: 20221439.
NW1229 C. elegans dpy-20(e1362) IV; evIs111. Show Description
evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression.
NW1619 C. elegans dpy-11(e224) mig-6(ev700) V/eT1 (III;V). Show Description
Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1623 C. elegans dpy-11(e224) mig-6(ev788) V/eT1 (III;V). Show Description
Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1625 C. elegans dpy-11(e224) mig-6(e1931) V/eT1 (III;V). Show Description
Heterozygotes are wild-type and segregate WT, Dpy-Ste Unc, and dead eggs. Maintain by picking wild-type.
NW906 C. elegans pag-1(ls2) III; dpy-20(e1282) IV; seu-2(ev523) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
NW988 C. elegans pag-1(ls2) III; dpy-20(e1282) IV; seu-3(ev555) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
OC519 C. elegans dpy-10(e128) sds-22(bs9) II. Show Description
Dpy. Reference: Peel N, et al. PLoS Genet. 2017 Jan 19;13(1):e1006543. doi: 10.1371/journal.pgen.1006543. PMID: 28103229.
OD2359 C. elegans fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. Show Description
CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2442 C. elegans ltSi794 II; unc-119(ed3) III. Show Description
ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. This transgenic strain mediates hypodermis-specific degradation of GFP-tagged proteins; can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
OG1119 C. elegans ogt-1(dr20) III; drIs4 IV; drEx469. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx469 [dpy-7p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Hypodermal expression of OGT-1 rescues presumptive null allele ogt-1(dr20). gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
OH10221 C. elegans ccIs4251 I; otIs77 II; ruIs37 III; jcIs1 IV; vsIs33 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
OH12930 C. elegans pha-1(e2123) III; evIs82b IV; otEx5966. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14044 C. elegans evIs82b IV; bnc-1(ot763) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14045 C. elegans evIs82b IV; bnc-1(ot721) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH16949 C. elegans otIs736; evIs111. Show Description
otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH17874 C. briggsae Cbr-dpy-10(ot1210) II. Show Description
Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.
OH2042 C. elegans lin-49(ot78) dpy-20(?) IV; otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain.
OH2638 C. elegans dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet.
OH2639 C. elegans dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1468. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1468 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1468 are DpyUnc. Animals which have lost the otEx1468 array are DpyUncLet.
OH2987 C. elegans otEx1768. Show Description
otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
OH2990 C. elegans otEx1771. Show Description
otEx1771[egl-15::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
OH3478 C. elegans oyIs14 V; egl-15(n484) X; otEx1270. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1270 [dpy-7p::egl-15(5A)cDNA + ceh-22p::GFP + pBS]. Maintain by picking worms with GFP expression in their pharynx.
OH4120 C. elegans rhIs4 III; wrk-1(ok695) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4125 C. elegans evIs82b IV; wrk-1(ok695) X. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4128 C. elegans juIs76 II; evIs82b IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4132 C. elegans vab-1(dx31) II; rhIs4 III; wrk-1(ok695) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4136 C. elegans rhIs4 III; wrk-1(tm1099) X. Show Description
rhIs4 [glr-1p::GFP + dpy-20(+)] III.
OH4329 C. elegans lsy-6(ot71) dpy-11(e224) V; otEx2322. Show Description
otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Faint ASE GFP expression (2 right). Expresses bright GFP in coelomocytes. Dpy.
OH4397 C. elegans otIs151; lsy-6(ot71) dpy-11(e224) V; otEx2419. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-(prom1)::GFP + unc-122::GFP]. Bilateral expression of GFP in ASE. Expresses bright GFP in coelomocytes. Rollers. Dpy. Maintain by picking GFP+.
OH4770 C. elegans ttx-3(mg158) X; otIs24. Show Description
otIs24 [sre-1::GFP + dpy-20(+)].
OH7213 C. elegans sax-7(ky146) IV; oyIs14 V; otEx3126. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx3126 [dpy-7p::sax-7cDNA long + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7235 C. elegans zdIs13 IV; otEx3154. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7236 C. elegans zdIs13 IV; otEx3155. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH7237 C. elegans zdIs13 IV; otEx3156. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH8421 C. elegans dpy-11 lsy-20(ot219) unc-76 V. Show Description
Whole genome sequenced strain.
OK245 C. elegans pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.
OK257 C. elegans peb-1(cu9)/dpy-3(e27) unc-2(e55) X. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and peb-1(cu9) homozygotes which arrest as larvae with a stuffed pharynx, abnormal hindgut and g1 gland cell morphology, and molting defects.
OK461 C. elegans bcl-11(cu10)/unc-46(e177) dpy-11(e224) V. Show Description
Pick wild-type to maintain. Heterozygotes are wild-type and should segregate wild-type heterozygotes, bcl-11 homozygotes (L1 larval arrest with starved appearance), and Dpy Unc homozygotes (Medium Dpy, Shrinker, poor backing). Maintain by picking wild-type and scoring for proper segregation of progeny. bcl-11 homozygotes have weak pharyngeal muscle contractions and pharyngeal lumen fails to open. cu10 is a 555 bp deletion (V:6360921..6361460). Predicted bcl-11 null allele. Reference: Vilimas, Tomas. (2004). Genes regulating ceh-22 and pharyngeal development of Caenorhabditis elegans.. University of Illinois at Chicago. Thesis. https://hdl.handle.net/10027/12060
OP32 C. elegans unc-119(ed3) III; wgIs32. Show Description
wgIs32 [dpy-27::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OT125 C. elegans mua-9(rh197)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.
PD2557 C. elegans rps-10(cc2557)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus cc2557 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. cc2557 is an engineered mutation creating an early stop (T8*). Presumptive rps-10 null. Heterozygous rps-10(cc2557)/tmC20 animals are delayed in development. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD2558 C. elegans rpl-33(cc2558)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Balancer recombination happens frequently at 23-25C, strain must be maintained at 16-20C. Homozygous lethal mutation balanced by Dpy- and myo-2p::GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP rpl-33(cc2558) homozygotes. Pick wild-type GFP+ to maintain. cc5998 is an engineered mutation creating an early stop (R9*). Presumptive rpl-33 null. Heterozygous rpl-33(cc2558)/mIn1 animals are delayed in development. Check for proper segregation of progeny. Reference: Cenik ES, et al. Dev Cell. 2019 Mar 25;48(6):811-826.e6. doi: 10.1016/j.devcel.2019.01.019. PMID: 30799226.
PD3011 C. elegans cyd-1(cc600) II; cup-5(ar465) III; arIs39 X. Show Description
arIs39 [myo-3p::ssGFP + dpy-20(+)].
PD4251 C. elegans ccIs4251 I; dpy-20(e1282) IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).
PD4285 C. elegans mls-1(cc569) III; ayIs2 IV. Show Description
ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles.
PD4443 C. elegans ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.