Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
NL1611 C. elegans dpy-20(e1282) IV; pkIs591. Show Description
pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.
NL1908 C. elegans acy-1(pk866) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1909 C. elegans acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1921 C. elegans acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1925 C. elegans acy-1(pk884) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.
NL1947 C. elegans acy-1(pk907) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL1999 C. elegans acy-1(pk1279)/dpy-17(e164) III. Show Description
Heterozygotes are wild-type and segregate Dpys, wild-type, and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1.
NL2328 C. elegans dpy-20(e1282) IV; pkIs1269. Show Description
pkIs1269 [gpa-13XS(+) + dpy-20(+)].
NL2334 C. elegans dpy-20(e1282) IV; pkIs1273. Show Description
pkIs1273 [gpa-16::GFP + dpy-20(+)].
NL2336 C. elegans dpy-20(e1282) IV; pkIs1275. Show Description
pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.
NL2808 C. elegans pxf-1(pk1331)/dpy-20(e1363) IV. Show Description
Pick WT to maintain. The pk1331 allele can be followed by PCR.
NL3161 C. elegans pkIs1330 I; tpa-1(pk1401) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL3231 C. elegans acy-1(pk484) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NL344 C. elegans gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), L1 arrested animals (pk44 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
NL3847 C. elegans pkIs1600 I; ruIs32 III. Show Description
pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.
NL4258 C. elegans pkIs1330 I; tpa-1(pk1585) dpy-20(e1282) IV. Show Description
pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.
NL545 C. elegans dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.
NL557 C. elegans dpy-20(e1362) IV; pkIs334. Show Description
pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.
NL585 C. elegans acy-1(pk301) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL587 C. elegans acy-1(pk311) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.
NL597 C. elegans acy-1(pk384) III; dpy-20(e1362) IV; pkIs296 X. Show Description
pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.
NM1081 C. elegans snb-1(js124)/dpy-11(e224) unc-68(r1158) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and L1 lethals. js124 homozygotes arrest as L1 larvae that are very uncoordinated and tend to adopt a coiled position. js124 molecular lesion is an amber mutation at codon 50.
NM4337 C. elegans rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
NM4431 C. elegans rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
NP1360 C. elegans arIs37 I; cup-14(cd31) II. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.
NP717 C.elegans arIs37 I; unc-119(ed3) III; cdls32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D) + myo-2p::GFP + unc-119(+)]. A diphtheria toxin A fragment DT-A (E148D) is expressed under a coelomocyte-specific promoter leading to the absence of coelomocytes. Worms are slightly uncoordinated, slightly dumpy and slow growing. References: Fares H & Greenwald I. Genetics. 2001 Sep;159(1):133-45. doi: 10.1093/genetics/159.1.133. PMID: 11560892. Schwartz MS, et al. PLoS One. 2010 Mar 5;5(3):e9564. doi: 10.1371/journal.pone.0009564. PMID: 20221439.
NW1229 C. elegans dpy-20(e1362) IV; evIs111. Show Description
evIs111 [F25B3.3::GFP + dpy-20(+)]. Pan-neural expression.
NW1619 C. elegans dpy-11(e224) mig-6(ev700) V/eT1 (III;V). Show Description
Heterozygotes display abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, Dpy, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1623 C. elegans dpy-11(e224) mig-6(ev788) V/eT1 (III;V). Show Description
Heterozygotes display partially penetrant (~10%) abnormal distal tip cell migration detectable as clear patches in anterior and posterior. Heterozygotes segregate WT, abnormal DTC migration, Unc, and dead eggs. Maintain by picking wild-type.
NW1625 C. elegans dpy-11(e224) mig-6(e1931) V/eT1 (III;V). Show Description
Heterozygotes are wild-type and segregate WT, Dpy-Ste Unc, and dead eggs. Maintain by picking wild-type.
NW906 C. elegans pag-1(ls2) III; dpy-20(e1282) IV; seu-2(ev523) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5; dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
NW988 C. elegans pag-1(ls2) III; dpy-20(e1282) IV; seu-3(ev555) evIs41 V. Show Description
evIs41[mec-7::lacZ; mec-7::unc-5 + dpy-20(+)] V. Suppresses axon guidance phenotype ofmec-7::unc-5. Has slight Uncoordinated phenotype.
OC519 C. elegans dpy-10(e128) sds-22(bs9) II. Show Description
Dpy. Reference: Peel N, et al. PLoS Genet. 2017 Jan 19;13(1):e1006543. doi: 10.1371/journal.pgen.1006543. PMID: 28103229.
OD2359 C. elegans fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. Show Description
CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2442 C. elegans ltSi794 II; unc-119(ed3) III. Show Description
ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
OG1119 C. elegans ogt-1(dr20) III; drIs4 IV; drEx469. Show Description
drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx469 [dpy-7p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Hypodermal expression of OGT-1 rescues presumptive null allele ogt-1(dr20). gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
OH10221 C. elegans ccIs4251 I; otIs77 II; ruIs37 III; jcIs1 IV; vsIs33 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.
OH12930 C. elegans pha-1(e2123) III; evIs82b IV; otEx5966. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14044 C. elegans evIs82b IV; bnc-1(ot763) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14045 C. elegans evIs82b IV; bnc-1(ot721) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH16949 C. elegans otIs736; evIs111. Show Description
otIs736 [cat-4p::mCherry + rol-6(su1006)]. evIs111 [F25B3.3::GFP + dpy-20(+)]. Rollers. Pan-neural GFP expression. The two HSN neurons are marked with both GFP and mCherry. Can be used to isolate HSN by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH17874 C. briggsae Cbr-dpy-10(ot1210) II. Show Description
Dpy Rol. Heterozygotes are Left-handed Rol. R92C mutation in Cbr-dpy-10 generated via CRISPR/Cas9. Homologous to the C. elegans dpy-10(cn64) mutation.
OH20145 C. elegans zfh-2(ot1709)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. zfh-2(ot1709) is a CRISPR/Cas9-engineered >30kb deletion of the entire zfh-2 locus. crRNA1: CTACCATTTAGCCAATATAT. crRNA2: GTAGTAGTAGTAGTATGAGG. ssODN: aaattcatccaaaaaaatttccagagttgccccgcccataCATACTACTACTACTACCACGACGACGCCATAAcaaaacc. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
OH2042 C. elegans lin-49(ot78) dpy-20(?) IV; otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain.
OH20425 C. elegans zfh-2(ot1787 *syb10278)/tmC20[unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
Homozygous sterile mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are non-Dpy with relatively dim pharyngeal GFP (Venus) expression, and segregate heterozygous non-Dpy Venus+, non-Venus ot1709 homozygotes (L1 arrest), and Dpy with brighter Venus+ (tmC20 homozygotes). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Second homeodomain deleted from endogenous zfh-2 locus tagged at C terminus with linker::mIAA7::mScarletI3::mIAA7. Linker sequence GSGGSGGTGGSG. ot1787 crRNA1: TCCTGCAACACGTCGTCCAG. crRNA2: CGGCGTTCTCACAAATCGAT. ssODN: ATGACACCGAGCACTCCTTCCTGCAACACGTCGTCCtcTGGACGAATCTATGAGAATCAGCCGAATCACGAGAGTTCtGATCGATTTGTGAGAACGCCGGGATCGAACTTTCAGTGC. Reference: Sussfeld A, et al. bioRxiv 2026.01.13.699069; doi: https://doi.org/10.64898/2026.01.13.699069.
OH2638 C. elegans dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1467. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1467 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1467 are DpyUnc. Animals which have lost the otEx1467 array are DpyUncLet.
OH2639 C. elegans dpy-17(e164) let-756(s2887) unc-32(e189) III; oyIs14 V; otEx1468. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1468 [let-756(+) + ceh-22p::GFP]. Animals carrying otEx1468 are DpyUnc. Animals which have lost the otEx1468 array are DpyUncLet.
OH2987 C. elegans otEx1768. Show Description
otEx1768 [let-756::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
OH2990 C. elegans otEx1771. Show Description
otEx1771[egl-15::GFP + dpy-7::RFP + rol-6(su1006)]. Maintain by picking Rollers.
OH3478 C. elegans oyIs14 V; egl-15(n484) X; otEx1270. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx1270 [dpy-7p::egl-15(5A)cDNA + ceh-22p::GFP + pBS]. Maintain by picking worms with GFP expression in their pharynx.