DTC reflexes but goes wrong way dorsal.

cul-1 was formerly known as lin-19.

Mua, late L4, tail first. Ventral cord abnormal.

Mua, not viable. Cytokinesis is defective in both hypodermis and germline resulting in mutinucleate cells.

Severe unc-104 allele, hypercontracted coiler. Dpy heterozygotes segregate Dpy, mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpy), and very small and sick dpy-10 unc-104 homozygotes.

pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs689 [gpa-1::GFP + dpy-20(+)]. Reporter construct includes 1.5 kb upstream and the first 8 exons of gpa-1 fused in frame with GFP. 4.3 kb HindIII - BglII fragment cloned in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

pkIs533[gpa-10XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs575 [gpc-1::GFP + dpy-20(+)]. Reporter construct includes 4.2 kbp of upstream sequences, and most of the gpc-1 coding region, fused in-frame to GFP. 5.0 kbp XbaI - ScaI fragment cloned into pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

pkIs503[gpa-1XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs515 [gpa-4XS(+) + dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs519 [gpa-6XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs523 [gpa-7(+) + dpy-20(+)].

pkIs527 [gpa-8XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs531[gpa-9XS(+) dpy-20(+)]. Not known to which LG the insertion is attached.

pkIs539 [gpa-11(XS)(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs552[gpa-14XS(+) dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs555 [gpa-15XS(+) + dpy-20(+)]. Not know to which LG the insertion is attached.

pkIs571[gpc-1XS dpy-20(+)]. No morphological changes. Locomotion and egg laying are slightly reduced.

pkIs582 [gpa-5::GFP + dpy-20(+)]. Reporter construct includes 4.5 kb upstream and the first 5 exons of gpa-5 fused in frame with GFP. 4.5 kb PstI - BamHI fragment cloned in pPD95.79. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs583 [gpa-6::GFP + dpy-20(+)]. GFP expression in AWA, ASI and PHB. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.

pkIs586 [gpa-9::GFP + dpy-20(+)]. GFP expression in ASJ, PHB, PVQ, pharynx muscle and spermatheca.

pkIs587 [gpa-10::GFP + dpy-20(+)].

pkIs588 [gpa-11::GFP + dpy-20(+)]. Reporter construct includes 3030 bp upstream of ATG to +98 in exon 1 fused in frame with GFP in pPD95.77. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs589 [gpa-13::GFP + dpy-20(+)]. Reference: Jansen G, et al. Nat Genet. 1999 Apr;21(4):414-9.

pkIs590 [gpa-14::GFP + dpy-20(+)]. GFP+.

pkIs591[dpy-20(+) + gap-15::GFP]. GFP expression in ADL, ASH, ASK, PHA, PHB, distal tip cell, anchor cell, and many male-specific neurons.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

Heterozygotes are wild-type and segregate Dpys, wild-type, and arrested larvae that hardly move or pump. Suppressor of activated Gs. sgs-1 also called acy-1.

pkIs1269 [gpa-13XS(+) + dpy-20(+)].

pkIs1273 [gpa-16::GFP + dpy-20(+)].

pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94.

Pick WT to maintain. The pk1331 allele can be followed by PCR.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

Heterozygotes are WT and segregate WT (heterozygotes), L1 arrested animals (pk44 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).

pkIs1600 [dpy-30::GFP(truncated) + rol-6(su1006)] I. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Rollers.

pkIs1330 [hsp::gpa-12QL + dpy-20(+)]. Suppressor of activated G12.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Heat-shock conditions are 2 hours at 33C, which results in degeneration of neurons.

pkIs334 [gsa-1(+) + dpy-20(+)]. gsa-1 overexpression. The strain is Egl-c and moves actively.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. acy-1 previously called sgs-1.

pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1.

Heterozygotes are WT and segregate WT, DpyUncs and L1 lethals. js124 homozygotes arrest as L1 larvae that are very uncoordinated and tend to adopt a coiled position. js124 molecular lesion is an amber mutation at codon 50.