| ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
| AD226 |
C. elegans |
egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| AF1 |
C. elegans |
+/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, dead eggs and Lon males. Maintain by picking WT.
|
|
| AG151 |
C. elegans |
cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals.
|
|
| AG152 |
C. elegans |
unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
|
|
| AG226 |
C. elegans |
rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
|
|
| AG50 |
C. elegans |
daf-7(e1372) dpy-1(e1) III. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive: 100% dauers at 25C, leaky at 20C. Dpy. Crowds.
|
|
| AGK640 |
C. elegans |
zdIs13 IV; pak-1(ok448) X; armEx252. Show Description
zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok448) HSN under-migration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
|
|
| AGK650 |
C. elegans |
daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
|
|
| AMH82 |
C. elegans |
ccIs4251 I; ddi-1(ok1468) IV. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1.
|
|
| AN170 |
C. elegans |
aff-1(ty4) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT (heterozygotes), Unc-4 worms which are strong Egl (ty4 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes).
|
|
| AS338 |
C. elegans |
dpy-6(e14) gly-13(ok712) X. Show Description
|
|
| ATD7 |
C. elegans |
par-2(ok1723)/sC1[dpy-1(s2170)], unc-119(ed3?) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Heterozygous worms are wild type and segregate wild type, Par (maternal effect lethal), and Dpy (sC1 homozygotes). Heterozygous and Par adults are indistinguishable on the plate. Maintain by picking wild-type worms and checking for correct segregation of progeny. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and VC1313. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
|
|
| ATU3301 |
C. elegans |
ccIs4251 I; aceIs1. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.
|
|
| AUM1535 |
C. elegans |
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
|
|
| AV125 |
C. elegans |
spe-8(hc40) I; dpy-4(e1166) IV. Show Description
Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy.
|
|
| AV1443 |
C elegans |
dao-5(ok542)/tmC18[dpy-5(tmIs1200)] I. Show Description
Heterozygotes are wild type with a green pharynx. They segregate Dpy, green pharynx, tmC18 homozygotes, and sterile, non-green pharynx, dao-5 homozygotes.
|
|
| AV308 |
C. elegans |
him-14(it21)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, DpyUncs (mnC1 homozygotes), and him-14 homozygotes that produce >95% dead embryos and 45% males. Among these surviving progeny, cytologically they have 12 univalents in diakinesis-stage oocytes owing to a failure to form crossovers during meiosis.
|
|
| AV311 |
C. elegans |
dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.
|
|
| AV554 |
C. elegans |
dpy-13(e184) unc-5(ox171) IV/nT1 [qIs51] (IV;V); krIs14 V/nT1 [qIs51] (IV;V). Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
|
|
| AV828 |
C. elegans |
nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
| AV860 |
C. elegans |
nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
|
|
| AWR63 |
C. elegans |
keaSi12 II; pals22(kea8[pals-22::GFP::AID*]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal GFP::AID* tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
| BA1013 |
C. elegans |
spe-6(hc49) vab-7(e1562)/qC1 [dpy-19(e1259) glp-1(q339)] III; spe-27(it132) IV. Show Description
Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.
|
|
| BA1061 |
C. elegans |
dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal.
|
|
| BA590 |
C. elegans |
spe-10(hc104) dpy-11(e224) V. Show Description
Dpy. Temperature sensitive, maintain at 16C. Average progeny at 16C= 7 +/- 5. At 25C, average progeny = 0.1 =/- .1.
|
|
| BA793 |
C. elegans |
spe-26(hc138) dpy-13(e184) IV. Show Description
Temperature sensitive. Fertile at 16C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA824 |
C. elegans |
spe-26(hc139) dpy-20(e1282) IV. Show Description
Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA825 |
C. elegans |
spe-26(hc140) dpy-20(e1282)/+ IV. Show Description
Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA901 |
C. elegans |
spe-27(it110) dpy-20(e1282) IV. Show Description
Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA.
|
|
| BA925 |
C. elegans |
spe-26(hc138) dpy-20(e1282) IV. Show Description
Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA959 |
C. elegans |
spe-29(it127) dpy-20(e1282) IV. Show Description
Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons.
|
|
| BA969 |
C. elegans |
spe-6(hc163) III; spe-27(it132) dpy-20(e1282) IV. Show Description
Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C.
|
|
| BA971 |
C. elegans |
spe-27(it132) dpy-20(e1282) IV. Show Description
Temperature sensitive spe-27 allele. Leaky sterile at 20C. Males at 20C produce spermatids that form spikes in pronase. Males are fertile. Temperature sensitive dpy-20 allele. Maintain at 15C.
|
|
| BA975 |
C. elegans |
spe-6(hc163) III; spe-29(it127) dpy-20(e1282) IV. Show Description
spe-6(hc163) suppresses the self-sterility of spe-29 in this strain. Self-sterile at 25C.
|
|
| BA979 |
C. elegans |
dpy-5(e61) spe-12(hc76) I; spe-6(hc163) III. Show Description
spe-6(hc163) suppresses hermaphrodite self-sterility of hc76. Dpy.
|
|
| BA984 |
C. elegans |
spe-6(hc163) dpy-18(e364) III. Show Description
Dpy. spe-6(hc163) suppresses self-sterility of spe-8, spe-12, spe-27, and spe-29 mutants. Causes precocious spermatide activation. Fertile between 15-25C.
|
|
| BB92 |
C. elegans |
dcr-1(ok247) III; uuEx18. Show Description
uuEx18 [dcr-1(wild-type) + dpy-30::mCherry]. Superficially wild-type. Reference: Welker N, et al. (2010) RNA 16:893-903.
|
|
| BB93 |
C. elegans |
dcr-1(ok247) III; uuEx19. Show Description
uuEx19 [dcr-1(K39A) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
|
|
| BB94 |
C. elegans |
dcr-1(ok247) III; uuEx20. Show Description
uuEx20 [dcr-1(D145N) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
|
|
| BB95 |
C. elegans |
dcr-1(ok247) III; uuEx21. Show Description
uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
|
|
| BC10002 |
C. elegans |
dpy-5(e907) I; sEx10002. Show Description
sEx10002[rCesC05D10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10004 |
C. elegans |
dpy-5(e907) I; sEx10004. Show Description
sEx10004 [rCes C54H2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10008 |
C. elegans |
dpy-5(e907) I; sEx10008. Show Description
sEx10008 [rCesF18E2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10010 |
C. elegans |
dpy-5(e907) I; sEx841. Show Description
sEx841[rCesF43E2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10011 |
C. elegans |
dpy-5(e907) I; sEx842. Show Description
sEx842 [rCesC34G6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10013 |
C. elegans |
dpy-5(e907) I; sEx844. Show Description
sEx844 [rCesF22E10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10016 |
C. elegans |
dpy-5(e907) I; sEx850. Show Description
sEx850 [rCesT21E8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10019 |
C. elegans |
dpy-5(e907) I; sEx853. Show Description
sEx853 [rCes W09D6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| BC10021 |
C. elegans |
dpy-5(e907) I; sEx855. Show Description
sEx855 [rCesC47A10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|