Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
NB320 C. elegans dna-2(jh115)/mIn1[dpy-10(e128) mIs14(GFP)] II. Show Description
Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. dna-2 homozygotes are non-GFP.  Reference: Lee, K.H., Lee, M.H., Lee, T.H., Han, J.W., Park, Y.J., Ahnn, J., Seo, Y.S. and Koo, H.S. (2003). Mol Cell 15, 81-6.
RG3276 C. elegans dna-2(ve776[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect sterile. Deletion of 3982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that produce sterile progeny (ve776 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatgtctgctgcccgcccgcccgttgcct ; Right flanking sequence: ccttttttactcatttattagatttctcac. sgRNA #1: gattctggctgcgaaatacg; sgRNA #2: cgggaattTTACAGTTGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.