Body wall muscle is disorganized when viewed using polarized light. Hermaphrodites move well and are indistinguishable from WT under dissecting microscope.

C18A11.7. Suppressed Unc. Left primer: TCCACCAACAAGCTTTTGCC. Right primer: CTCAGTCGATCACAATACAG. WT amplicon: 1031 bp. Deletion size: 133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.

The unc-112(r367); raDf6/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf6 homozygotes arrest during embryogenesis. raDf6 deletes dim-1.

raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.

The unc-112(r367); raDf9/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf9 homozygotes arrest as L1 or L2 larvae. raDf9 deletes dim-1.

The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.

The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.

The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.