More Fields
Strain Species Genotype
PS9551 C. elegans  syIs816; syIs300. Show Description
syIs816 [ocr-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for OLQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9663 C. elegans syEx1708; syIs300. Show Description
syEx1708 [dat-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for dopaminergic neurons (CEP, ADE, PDE). syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9665 C. elegans syIs300; syEx1711. Show Description
syEx1711[nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9666 C. elegans syIs300; syEx1712. Show Description
syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PX696 C. elegans fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
RG3093 C. elegans +/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SJ4202 C. elegans zcIs22. Show Description
zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].
WRM6 C. elegans sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM7 C. elegans sprSi7II; unc-119(ed3) III. Show Description
sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM8 C. elegans sprSi8II; unc-119(ed3) III. Show Description
sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM9 C. elegans sprSi9II; unc-119(ed3) III. Show Description
sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
BX17 C. elegans fat-4(wa14) IV. Show Description
No delta5 fatty acid desaturase activity.
BX30 C. elegans fat-3(wa22) IV. Show Description
Slow growing. Unc. Dpy. No delta6 fatty acid desaturase activity.
CDH2 C. elegans pduEx2. Show Description
pdeEx2 [pCE-bJUN-VN173 + pCE-bFOSdeltaZIP-VC155 + rol-6(su1006)]. Pick Rollers to maintain. Heat-shock induces protein expression but NO BiFC complementation.
DG2160 C. elegans tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
DG2189 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.
NK564 C. elegans unc-119(ed4) III; qyEx78. Show Description
qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.
NM5322 C. elegans jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
OD58 C. elegans unc-119(ed3) III; ltIs38. Show Description
ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)].
OD62 C. elegans unc-119(ed3) III; ltIs42. Show Description
ltIs42[pAA19; pie-1::GFP-TEV-Stag::CAR-1deltaN; unc-119(+)].
OD70 C. elegans unc-119(ed3) III; ltIs44 V. Show Description
ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
OD73 C. elegans unc-119(ed3) III; ltIs38; ltIs24. Show Description
ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. ltIs24 [pAZ132; pie-1::GFP::tba-2 + unc-119(+)].
OD95 C. elegans unc-119(ed3) III; ltIs37 IV; ltIs38. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: McNally et al., JCB (2006).
OH7216 C. elegans sax-7(ky146) IV; oyIs14 V; otEx3140. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx3140 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
OH7217 C. elegans sax-7(ky146) IV; oyIs14 V; otEx3141. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx3141 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
PHX1812 C. elegans cfi-1(syb1812[cfi-1(delta_enhancer)::mNG::AID]) I. Show Description
A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
RAF2 C. elegans unc-119(ed3) III; rrrIs2. Show Description
rrrIs2 contains [pie-1p::GFP::Histone H2B::cye-1 3'UTR (S1mt+deltaS2-3)+ unc-119(+)]. Slightly Unc.
TMD67 C. elegans mikSi1 II; ltIs38. Show Description
mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256.
XA6902 C. elegans pha-1(e2123) III; qaEx6902. Show Description
qaEx6902 [ftn-1p(delta63)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.