More Fields
Strain Species Genotype
PS9031 C. elegans syIs743; syIs300. Show Description
syIs743 [pks-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for CAN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9229 C. elegans syIs748; syIs300. Show Description
syIs748 [tbh-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9232 C. elegans syIs751; syIs300. Show Description
syIs751 [ttr-39p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for DD and VD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9235 C. elegans syIs768; syIs300. Show Description
syIs768 [aqp-6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for IL1 neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9441 C. elegans syIs794; syIs337. Show Description
syIs794 [F47D2.11::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9443 C. elegans syIs796; syIs300. Show Description
syIs796 [F35D11.1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, F09E10.7p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for CEP neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9534 C. elegans syIs799; syIs300. Show Description
syIs799 [F58F6.6p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9542 C. elegans syIs807; syIs337. Show Description
syIs807 [pps-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASJ neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9547 C. elegans syIs812; syIs337. Show Description
syIs812 [srj-26p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9550 C. elegans syIs815; syIs337. Show Description
syIs815 [nlp-76p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ASH neurons. syIs337 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS9551 C. elegans syIs816; syIs300. Show Description
syIs816 [ocr-4p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for OLQ neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9663 C. elegans syEx1708; syIs300. Show Description
syEx1708 [dat-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for dopaminergic neurons (CEP, ADE, PDE). syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9664 C. elegans syIs300; syEx1709. Show Description
syEx1709 [arrd-16p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. cGAL driver for URY neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with the transgenic marker in next generation.
PS9665 C. elegans syIs300; syEx1711. Show Description
syEx1711[nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
PS9666 C. elegans syIs300; syEx1712. Show Description
syEx1712[T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for ALN and PLN neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
PS9668 C. elegans syIs300; syEx1714. Show Description
syEx1714 [flp-11p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR, seb-3p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] split cGAL driver for OLL neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation.
PS9672 C. elegans syIs300; syEx1718. Show Description
syEx1718 [kcnl-4p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + F58F6.6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. Split cGAL driver for PHC neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. GFP cGAL effector.
PS9673 C. elegans syIs300; syEx1719. Show Description
syEx1719 [kcnl-4p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + Y48G10A.6p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Pick animals with RFP expression in coelomocytes to maintain. Split cGAL driver for FLP and PVD neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. GFP cGAL effector.
PS9675 C. elegans syIs840; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs840 [T09B9.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PS9676 C. elegans syIs841; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs841 [nlp-20p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PS9893 C. elegans syIs844; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs844 [srd-36p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ASK neurons.
PS9896 C. elegans syIs852; syIs300. Show Description
syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is GFP cGAL effector. syIs852 [C50F7.5p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. Some worms do not express ttx-3p::RFP marker, but will consistently produce worms with transgenetic marker in next generation. cGAL driver for ALN and PLN neurons.
PX696 C. elegans fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924
PX725 C elegans fxSi8 I. Show Description
fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX726 C elegans fxSi9 I. Show Description
fxSi9 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi9 is a CRISPR-engineered site in the MY16 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi9 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX727 C elegans fxSi10 I. Show Description
fxSi10 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi10 is a CRISPR-engineered site in the CB4856 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi10 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX728 C elegans fxSi11 I. Show Description
fxSi11 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi11 is a CRISPR-engineered site in the JU775 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi11 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).
PX736 C elegans fxSi13 III. Show Description
fxSi13 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::Lox2272 (III:10158855)]. fxSi13 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTCCAGCGGCAGATCGGCGGAGG) with a split hygromycin resistance selection marker; fxSi13 also introduced a small deletion of genomic sequence at the insertion site (III:10158856-10158894).
PX740 C. elegans fxIs47 II. Show Description
fxIs47 [rps-0p::5’ (delta)HygR::GCGAAGTGACGGTAGACCGT::3’ (delta)HygR::unc-54 3’::LoxP, II:8420157]. Phenotypically wild-type strain carrying a landing pad for barcode integrations. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
RG3093 C. elegans +/nT1[umnIs49] IV; eif-2Bdelta(ve593[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SJ4202 C. elegans zcIs22. Show Description
zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].
WRM6 C. elegans sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM7 C. elegans sprSi7II; unc-119(ed3) III. Show Description
sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM8 C. elegans sprSi8II; unc-119(ed3) III. Show Description
sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM9 C. elegans sprSi9II; unc-119(ed3) III. Show Description
sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
BX17 C. elegans fat-4(wa14) IV. Show Description
No delta5 fatty acid desaturase activity.
BX30 C. elegans fat-3(wa22) IV. Show Description
Slow growing. Unc. Dpy. No delta6 fatty acid desaturase activity.
CDH2 C. elegans pduEx2. Show Description
pdeEx2 [pCE-bJUN-VN173 + pCE-bFOSdeltaZIP-VC155 + rol-6(su1006)]. Pick Rollers to maintain. Heat-shock induces protein expression but NO BiFC complementation.
DG2160 C. elegans tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
DG2189 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.
EAG28 C. elegans eagIs6[*fxIs10] II; ltIs44 IV. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
JH4073 C. elegans pgl-3(ax4516[pgl-3(delta448-693)::3xFLAG]) V; meg-3(ax3054[meg-3::meGFP]) X. Show Description
3xFlag tag inserted at truncated C-terminus of endogenous pgl-3 locus. Inserted into parental strain JH3503 meg-3(ax3054[meg-3::meGFP]). Reference: Ouyang JPT, et al. Nature Cell Biology 2022 (24)1129–1140. DOI: 10.1038/s41556-022-00940-w.
NK564 C. elegans unc-119(ed4) III; qyEx78. Show Description
qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.
NM5322 C. elegans jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
OD58 C. elegans unc-119(ed3) III; ltIs38. Show Description
ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)].
OD62 C. elegans unc-119(ed3) III; ltIs42. Show Description
ltIs42[pAA19; pie-1::GFP-TEV-Stag::CAR-1deltaN; unc-119(+)].
OD70 C. elegans unc-119(ed3) III; ltIs44 V. Show Description
ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
OD73 C. elegans unc-119(ed3) III; ltIs38; ltIs24. Show Description
ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. ltIs24 [pAZ132; pie-1::GFP::tba-2 + unc-119(+)].
OD95 C. elegans unc-119(ed3) III; ltIs37 IV; ltIs38. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417
OH7216 C. elegans sax-7(ky146) IV; oyIs14 V; otEx3140. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx3140 [unc-14p::sax-7cDNA long-delta11 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.