More Fields
Strain Species Genotype
MT13664 C. elegans nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. Show Description
n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
MT13669 C. elegans nDf51 V. Show Description
Retarded heterochronic phenotype. Worms reiterate L2-stage programs, have extra seams cells, gapped alae, and >30% burst at the vulva at the L4 molt. Phenotype suppressed post-dauer. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT13897 C. elegans mir-241(n4316) V. Show Description
Superficially WT. Deletion is in cosmid F56A12 from 7299-7756. mir-241 is at 7661-7681.
MT13949 C. elegans mir-80(nDf53) III. Show Description
Deletion breakpoints are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / GATTAGGAGAGTATAGACATCGAAAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13952 C. elegans lgc-53(n4330) X. Show Description
1.463 kb deletion in T21F2.1 encoding ligand-gated chloride channel. Homozygous viable.
MT13954 C. elegans mir-81&mir-82(nDf54) X. Show Description
Deletion breakpoints are: AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13971 C. elegans hpl-1(n4317) X. Show Description
Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.
MT14091 C. elegans mir-79(n4126) I. Show Description
Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14117 C. elegans mir-2(n4108) I; nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14119 C. elegans nDf50 II. Show Description
Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14171 C. elegans met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
MT14347 C. elegans mir-273(n4438) II. Show Description
Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14355 C. elegans ftt-2(n4426) X. Show Description
Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null.
MT14401 C. elegans set-12(n4442) X. Show Description
Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.
MT14446 C. elegans mir-228(n4382) IV. Show Description
Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14449 C. elegans mir-232(nDf56) IV. Show Description
Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14450 C. elegans mir-51(n4473) IV. Show Description
Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14451 C. elegans mir-76(n4474) III. Show Description
Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14452 C. elegans mir-46(n4475) III. Show Description
Deletion breakpoints are:CTATGAATGTTTAAAA / AAAAAAATTTTTTGAAAAGTAAGCAA...AGAGCCCTAAAAGTCTTAACT / GTTCTGCGCAACTTTCGACAACGTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14480 C. elegans set-11(n4488) II. Show Description
Deletion allele. Reference: Andersen EC, Horvitz HR. Development. 2007 Aug;134(16):2991-9.
MT14525 C. elegans mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14531 C. elegans prg-2(nDf57) IV. Show Description
Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).
MT14533 C. elegans nDf50 nDf49/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.
MT14588 C. elegans mir-234(n4520) II. Show Description
Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14615 C. elegans set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes).
MT14661 C. elegans mir-265(n4534) IV. Show Description
Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14662 C. elegans mir-230(n4535) X. Show Description
Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14666 C. elegans egl-6(n4537) X. Show Description
2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.
MT14673 C. elegans mir-359(n4540) X. Show Description
Deletion breakpoints are: TGTTTTATAGAAAGCTGAGGGTGTGTGTGTGTG / CCAGATGG_GTAAGTGAATT / GTTTTGTGTAGATGGTGGAAATGAGCAGGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14678 C. elegans lgc-40(n4545) X. Show Description
1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable.
MT14680 C. elegans lgc-55(n4331) V. Show Description
1.986 kb deletion in Y113g7A.5 encoding ligand-gated chloride channel. Homozygous viable.
MT14682 C. elegans mir-257(n4548) V. Show Description
Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14748 C. elegans nDf51 V; nEx1184. Show Description
nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT14767 C. elegans mir-54&mir-55(nDf58) X. Show Description
Deletion breakpoints are: GAATGTTCACTGAGCTCTACATCATTG / TTCAAACAGTTT...AAGTTGTGATCTAC / AATTATCTTTGGATTTTTAATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14768 C. elegans mir-231(n4571) III. Show Description
Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14778 C. elegans nDf51 V; nEx1192. Show Description
nEx1192 [sur-5::GFP]. Maintain by picking GFP+. nEx1192 does not rescue the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT14851 C. elegans set-2(n4589) III. Show Description
Deletion allele.
MT14875 C. elegans nDf59 V. Show Description
mir-61 (F55A11.9), mir-250 (F55A11.12) and part of F55A11.3 are deleted in nDf59. Deletion breakpoints are:TGGATTTCCACAACAACCAGCTGGTGCC / GGAGGTGCTCAGCCTGG...GTTCTAGTCATTGCC / ATACGGAGGAAGGACTAAGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14876 C. elegans mir-261(n4594) II. Show Description
Deletion breakpoints are:TTTTCGAATTGGCTTATG / AACCGATGGCATTTTCTTCTC...TGCAAATTGGGGCCAACA / ATACAATAGGTGTAAAATGGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14878 C. elegans mir-270(n4595) IV. Show Description
Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14910 C. elegans pyp-1(n4599) IV/nT1 [qIs51] (IV;V). Show Description
n4599: C47E12.4 deletion from AA12F3.
MT14911 C. elegans set-4(n4600) II. Show Description
C32D5.5 deletion allele.
MT14919 C. elegans mir-260(n4601) II. Show Description
Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects
MT14935 C. elegans mir-59(n4604) IV. Show Description
Deletion breakpoints are: GAAATAAGGCTCTACAGT / ATGCTCAGACATAAATTA...ACGGTAGCTCCACGGGCAT / TTTAATGACAACTTACATAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14936 C. elegans mir-242(n4605) IV. Show Description
Deletion breakpoints are: GTACCTAGACAATATTCCT / CACCAACCTCAATTCAACAC...GGCTTAAGCTTAGGCGAATA / CAATCAATTTTTCAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14937 C. elegans mir-251(n4606) X. Show Description
Deletion breakpoints are: TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15018 C. elegans mir-360(n4635) X. Show Description
Deletion breakpoints are:ACGTGCTGTAAAAATTTGCGG / ATACCAAGCCTACAGTTGATTT...GGGACTTTGGGCGGCTTA / AAGTGTCACTGGTCTGGACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15019 C. elegans nDf60 V. Show Description
mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15020 C. elegans mir-246(n4636) IV. Show Description
Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15021 C. elegans mir-78(n4637) IV. Show Description
Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.