Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx384 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD) + rol-6(su1006)]. Rollers. Rollers express HMR-1 intracellular domain pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

Homozygous viable. 775 bp deletion. 24926/24927 - 25701/25702. Primer 1: att gcc aat gcc gtt ctt cc (forward primer to the left of deletion). Primer 2: tat tat ttc gcg tcg gag cg (forward primer lies in the deletion). Primer 3: att tat gca gga gcg gca ag (reverse primer to the right of deletion). In sod-5(+) you see 720 bp product with primer 2 and 3. reliable PCR. in sod-5(+) expected product size is 1315 bp with primer 1 and 3. not always reliable. In sod-5 (tm1146) you see 540 bp product with primer 1 and 3. reliable PCR. In sod-5(tm1146), you see no product with primer 2 and 3. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(egl-4 unc-17) IV. Covered region (Mb) 1.8 (1.8..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Homozygous lethal deletion allele balanced by Unc-marked translocation. Break points: In(jtr-1 unc-17) IV. Covered region (Mb) 2.2 (1.4..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(mec-3 unc-31) IV. Covered region (Mb) 2.3 (10.5..12.8) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(ced-2 unc-17) IV. Covered region (Mb) 2 (1.6..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1). Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type heterozygotes, Dpy (tmIn14 homozygotes), and unc-15 homozygotes. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Deletion allele. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

No obvious phenotype. 446 bp deletion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. 612 bp deletion. 17154/17155 - 17766/17767. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

No obvious phenotype. 625 bp deletion + 7 bp insertion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Temperature-sensitive sterile; maintain at 15-20C. uae1 is a CRISPR-engineered deletion of the mip-1 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.

Temperature-sensitive sterile; maintain at 15-20C. uae2 is a CRISPR-engineered deletion of the mip-2 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.

unc-70(cas983) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806

aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399

Superficially wild-type. Endogenously tagged met-2 locus, with MET-2::mCherry signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

CRISPR-engineered whole-gene deletion of lin-65. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

Superficially wild-type. Endogenously tagged lin-65 locus, with LIN-65::GFP signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

Superficially wild-type. Endogenously tagged met-2 and lin-65 loci. MET-2::mCherry and LIN-65::GFP signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265

1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.

Isolated from a deletion library.

nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.

Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

Null allele. CRISPR-engineered deletion of the tdp-1 locus precisely eliminates all known tdp-1 exons and introns. Reference: Lins J, et al. Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants. MicroPubl Biol. 2023 Jun 6;2023:10.17912/micropub.biology.000693. doi: 10.17912/micropub.biology.000693. PMID: 37351305.

Deletion allele generated by the Mitani Lab.

Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type. Primers for crossing: Fwd: cgagacttttaaccccgtcg InFwd: aaagcccatgacttgctgaa Rev: gctcaggtggttagagggtt Wild-type bands: 580bp, 2652bp. Mutation band: 335bp.

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.

goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.

Sid. Deletion allele. Reference: Whangbo JS, et al. G3 (Bethesda). 2017 Oct 12 [Epub ahead of print]. pii: g3.300308.2017. doi: 10.1534/g3.117.300308. PMID: 29025917.

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.