More Fields
Strain Species Genotype
EM347 C. elegans tlp-1(bx85) IV; him-5(e1490) V. Show Description
Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal "SPLALLA" domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.
ET100 C. elegans H01G02.2(ok200) IV. Show Description
H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
ET137 C. elegans C30G12.1(ok910) II. Show Description
C30G12.1 Homozygous. No overt morphological or behavioral abnormalities. 1286 bp deletion. The region of cosmid C30G12 that is deleted is 39,238 - 40,523 bps (inclusive). The deletion includes an ectopic 5 bp sequence, GGTTA. The sequence crossing the deletion for ok910 is: ....GCCATGGTTAAAAGT GGTTA AAAAATTCAGTATAT... This deletion was generated by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publication resulting from its use. http://www.mutantfactory.ouhsc.edu/
EU1383 C. elegans act-2(ok1229) V. Show Description
Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exn and extending beyond the 3' UTR.
EU3115 C elegans klp-15(ok1958) klp-16(or1952)/tmC18[dpy-5(tmIs1236)] I; ltIs37 IV; ruIs57. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020
EU626 C. elegans rfl-1(or198) III. Show Description
Temperature sensitive maternal effect lethal mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.
EU855 C. elegans mom-2(or309) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, WT which give only dead eggs, and dead eggs. or309 is a deletion allele: removes exon 4 to 3' end and leave about 100 N-terminal amino acids.
EV190 C. elegans gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.
EV57 C. elegans gls-1(ef8) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.
FAS32 C. elegans his-74(uge16[gfp::his-74]) V. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS34 C. elegans his-74(uge18) V. Show Description
Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS43 C. elegans his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS45 C. elegans hira-1(uge29) III. Show Description
Null mutant of hira-1. Temperature-sensitive. Can be maintained at 20C. Developmental defects include protruding vulva and reduced brood size at 20C; nearly sterile at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS46 C. elegans his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS47 C. elegans his-70(uge31[gfp::his-70]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS65 C. elegans his-69&his-70(uge44) III. Show Description
Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FAS84 C. elegans his-71(uge45[gfp::his-71]) X. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FK163 C. elegans cam-1(ks52) II. Show Description
Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.
FT1568 C. elegans unc-119(ed3) III; xnIs371; xnEx384. Show Description
xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx384 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD) + rol-6(su1006)]. Rollers. Rollers express HMR-1 intracellular domain pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.
FT1569 C. elegans unc-119(ed3) III; xnIs371; xnEx385. Show Description
xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.
FX1146 C. elegans sod-5(tm1146) II. Show Description
Homozygous viable. 775 bp deletion. 24926/24927 - 25701/25702. Primer 1: att gcc aat gcc gtt ctt cc (forward primer to the left of deletion). Primer 2: tat tat ttc gcg tcg gag cg (forward primer lies in the deletion). Primer 3: att tat gca gga gcg gca ag (reverse primer to the right of deletion). In sod-5(+) you see 720 bp product with primer 2 and 3. reliable PCR. in sod-5(+) expected product size is 1315 bp with primer 1 and 3. not always reliable. In sod-5 (tm1146) you see 540 bp product with primer 1 and 3. reliable PCR. In sod-5(tm1146), you see no product with primer 2 and 3. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX17650 C. elegans lin-1(tm5929)/tmIn1 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(egl-4 unc-17) IV. Covered region (Mb) 1.8 (1.8..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19059 C. elegans Y38F2AR.9(tm1986)/tmIn3 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Break points: In(jtr-1 unc-17) IV. Covered region (Mb) 2.2 (1.4..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19161 C. elegans dpy-20(tm5940)/tmIn5 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(mec-3 unc-31) IV. Covered region (Mb) 2.3 (10.5..12.8) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19163 C. elegans mca-3(tm6395)/tmIn11 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19170 C. elegans lin-1(tm5929)/tmIn2 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(ced-2 unc-17) IV. Covered region (Mb) 2 (1.6..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19181 C. elegans unc-15(tm6329)/tmIn14 I. Show Description
Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1) Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX536 C. elegans ced-13(tm536) X. Show Description
Deletion allele. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX627 C. elegans lgc-11(tm627) X. Show Description
No obvious phenotype. 446 bp deletion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX776 C. elegans sod-1(tm776) II. Show Description
Homozygous viable. 612 bp deletion. 17154/17155 - 17766/17767. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX863 C. elegans acr-7(tm863) II. Show Description
No obvious phenotype. 625 bp deletion + 7 bp insertion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GKC1 C elegans mip-1(uae1) III. Show Description
Temperature-sensitive sterile; maintain at 15-20C. uae1 is a CRISPR-engineered deletion of the mip-1 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.
GKC2 C elegans mip-2(uae2) V. Show Description
Temperature-sensitive sterile; maintain at 15-20C. uae2 is a CRISPR-engineered deletion of the mip-2 coding region. Reference: Cipriani PG. et al. Elife. 2021 Jul 5;10:e60833. doi: 10.7554/eLife.60833.
GOU3237 C. elegans unc-70(cas983) V. Show Description
unc-70(cas983) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3601 C. elegans unc-70(cas1050[unc-70(delta H590-L598)::GFP]) V. Show Description
unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GR1309 C. elegans daf-16(mgDf47) I; daf-2(e1370) III. Show Description
mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
GR1321 C. elegans tph-1(mg280) cam-1(vs166) II. Show Description
Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.
GR2272 C. elegans rnp-2(mg582) IV. Show Description
CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806
GW1119 C. elegans lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V). Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399
GW1419 C. elegans met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 locus, with MET-2::mCherry signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1482 C. elegans bqsi433 II; bqSi495 cec-4(ok3124) IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
GW1483 C. elegans bqSi447 II; bqSi495 cec-4(ok3124) IV; ygIs1. Show Description
bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1562 C. elegans lin-65(gw1465) I. Show Description
CRISPR-engineered whole-gene deletion of lin-65. Worms are slow growing with reduced brood size and become sterile at elevated temperatures. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1618 C. elegans lin-65(gw1578[lin-65::FLAG::TEV::GFP]) I. Show Description
Superficially wild-type. Endogenously tagged lin-65 locus, with LIN-65::GFP signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1621 C. elegans lin-65(gw1578[lin-65::FLAG::TEV::GFP]) I; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and lin-65 loci. MET-2::mCherry and LIN-65::GFP signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1623 C. elegans arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GWJ1 C. elegans lap-1(pk486). Show Description
1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.
HA1019 C. elegans osm-11(rt142) X. Show Description
Isolated from a deletion library.
HA2823 C.elegans smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.