Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.

Deletion of mir-788 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.

Deletion of mir-799 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.

Deletion of mir-82 pre-miRNA via CRISPR/CAS9 and CRE/lox. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.

Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Viable and fertile. Deletion of 664 bp, molecular null.

Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;

Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer.

Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. Molecular null, deletion removes promoter region. Homozygous viable and fertile, fecundity reduced by approximately 30%. nid-1=F54F3.1.

Homozygous viable and fertile. Partially penetrant Egl and cell/axon guidance defects. Deletion of nucleotides 22756-24758 based on cosmid F39H11 sequence (Genbank AF164959). Results in loss of carboxyl NC1 domain from CLE-1.

Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.

twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. Superficially wild-type. Normal dauer formation. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.

Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Superficially wild-type. knu867 is a 6955 bp deletion in agl-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com

knu869 is a 4077 bp deletion in sul-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com

ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10.

knu1099 is an engineered 7437 bp deletion in spin-4. Flanking sequences immediately outside of the region deleted ares: 5? flank (forward strand), 5?- GTT CGG TGG AGC GCG CCT GCG -3’; 3? flank (reverse strand), 5?- GTC TGT GTT GCT GTT CCT CAT -3’. In between these flanking sequences, a three-frame stop as well as a unique primer-binding sequence were inserted in place of the deleted sequence. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Flora Y & Bohnert KA. Dev Biol. 2023 Dec:504:137-148. doi: 10.1016/j.ydbio.2023.09.013. PMID: 37805103.

Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.

Derived from AF16. Outcrossed >6x to AF16. Unc, slightly Dpy, no dauer formation (similar to C. elegans unc-119). nm67 is a deletion (827 bp) in Cbr-119 begining in exon 1 and ending 3' of exon 4. Reference: Liu Q, et al. Development. 2012 Apr;139(8):1509-21.

968 bp deletion. Engulfment defects.

tm2443 is a 204 bp deletion + 7 bp insertion in 21762/21763-TTTTCTC-21966/21967. A low penetrance (1/25) of chromosome bridges is observed at anaphase I. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.

acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion. Increased histone acetylation. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.

Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.

668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.

CRISPR-engineered deletion of esyt-2 from middle of 5'UTR to middle of 3'UTR using guide RNAs crCP01 (GGTTTCAGTAATTGTGGGCT) and crCP02 (GTGCACTTACGGGTTGTAGG). Superficially wild-type. Reference: Piggott CA, et al. Genetics. 2021 Apr 19;iyab063. doi: 10.1093/genetics/iyab063. PMID: 33871019.

2505bp deletion in cosmid T07D1. Break points are 6562 and 9069 with respect to T07D1. Sequence at the break point is: GGAAAAAAAAACTTCGCG / TTTGGCTAGTCGTAT. Primers: ok296u1: CTGAAACCATCTGACAGA; ok296d1: CATCGGAATAGGATTGTTG; ok296d2: CATTAGGTTTACAGGCTTAG. ok296d1u1 = 290bp product with WT allele. ok296d2u1 = 352 bp product with ok296 allele.

1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele.

vab-1 null phenotype. e2027 is a 74 bp deletion allele.

Small intragenic deletion. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations.

Deletion of bp 1108-3194 of C31H5.3

Deletion of bp 433-1994 of K02F2.6.

F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.

Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.

F59C12.2. Homozygous. Outer Left Sequence: AAGCATCTTTGAGCGCATTT. Outer Right Sequence: CATAGCGAGTGTTTGGAGCA. Inner Left Sequence: AATTTCAGGGGTGTGGACAT. Inner Right Sequence: AATCATTTTTGAAACCGACCC. Inner Primer PCR Length: 2926 bp. Deletion Size: 859 bp. Deletion left flank: TGTTTTGTAAGCTTTGTAAAATTATGTAGT. Deletion right flank: CCACTAGAAATAATTTCCCCCTTCTTTTTC. URL: http://www.celeganskoconsortium.omrf.org.

n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization.

C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].