More Fields
Strain Species Genotype Add
MLC1947 C. elegans dct-1(luc145) X. Show Description
dct-1 gain-of-function allele created by replacing two miR-1 binding sites (ACATTCCA) in the 3' UTR of the endogenous locus with NotI (GCGGCCGC) restriction sites. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC2543 C. elegans dct-1(luc194) X. Show Description
CRISPR/Cas9-engineered deletion removes the entire dct-1 coding sequence. Homozygote mutant animals are viable and have normal morphology. Outer left sequence: gtttcagagacgggtctttcctaaca Outer right sequence: ttccaaacaaaaattttaacgttcgactta sgRNA1: ACAGCAGACGGAGCAGTCAT sgRNA2: GTACAGTGAAATGAGGTAAG Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
CHS1252 C. elegans t10h9.1(yum2567) zc443.7(yum2568) y57a10c.10(yum2569) w05h5.1(yum2570) y57a10c.8(yum2571) f38h12.5(yum2572) y57a10c.9(yum2573) dct-12(yum2574) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
VC2323 C. elegans dct-13(gk992) IV. Show Description
Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2371 C. elegans W03B1.2(gk3214) dct-15(gk3215) IV; C47E8.6(gk1082) V; F53H4.5(gk3216) X. Show Description
This strain is homozygous for a deletion (gk1082) in C47E8.6, detectable by PCR using the following primers. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 468 bp. Deletion left flank: GACCAATGCAGCTTCCCGTCGAAAACCTGC. Deletion right flank: GAATATCTTAAGACAATCTGATGATCTTCT. Validation: gk1082 passed by diagnostic PCR, CGH. Other deletions (gk3214, gk3215, gk3216) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3240 C. elegans dct-14(gk3188) V. Show Description
This strain is homozygous for a deletion (gk3188) in Y38H6C.3, detectable by PCR using the following primers. External left primer: ACGAAGACCGTTTTTGCAGT. External right primer: CCATCAAGATTACCCTCCGA. Internal left primer: TGTCGGCCGATGTAGATAAA. Internal right primer: CTCCGAGTGTCGAGGAGAAG. Internal WT amplicon: 978 bp. Deletion size: 286 bp. Deletion left flank: ACATAGCGCTTGGGCCAAGAAGTACTAGGA. Deletion right flank: AAATTATATGTTTCTCAAAAAAAAACTCAC. Insertion Sequence: G. Validation: gk3188 validated by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807