More Fields
Strain Species Genotype
VC3864 C. elegans daf-37(gk3829[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CHS1085 C. elegans daf-37(yum1511) II; daf-38(yum1512) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.