More Fields
Strain Species Genotype
PJ1132 C. elegans daf-18(e1375) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dauer defective. May make bags of worms at low frequency??
PJ1194 C. elegans daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.
PJ1272 C. elegans daf-4(m592) III; daf-18(e1375) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Abnormal-looking dauers form at 25C.
PJ1276 C. elegans daf-8(e1393) I; daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.
PR821 C. elegans daf-10(p821) IV. Show Description
Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphid neurons with FITC.
QQ253 C. elegans daf-16(mgDf50) I; daf-2(m65) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.
RB2620 C. elegans daf-14(ok3647) IV. Show Description
F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB712 C. elegans daf-18(ok480) IV. Show Description
T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW11614 C. elegans unc-119(tm4063) III; stIs11614. Show Description
stIs11614 [daf-16f::H1-wCherry + unc-119(+)].
RW11691 C. elegans unc-119(tm4063) III; stIs11691. Show Description
stIs11691 [daf-16d::H1-wCherry + unc-119(+)].
SD1778 C. elegans daf-16(mu86) I; daf-2(e1370) III; stIs10161. Show Description
stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.
ST9005 C. elegans ncEx9005. Show Description
ncEx9005 [lin-32p::FLAG::let-363 + lin-32p::Myc::daf-15 + lin-32p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing lin-32p followed by the FLAG-, Myc- and HA-coding sequences to generate lin-32p::FLAG::let-363, lin-32p::Myc::daf-15 and lin-32p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.
ST9007 C. elegans ncEx9007. Show Description
ncEx9007 [unc-54p::FLAG::let-363 + unc-54p::Myc::daf-15 + unc-54p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing inserted into pPD30.38 containing unc-54p followed by the FLAG-, Myc- and HA-coding sequences to generate unc-54p::FLAG::let-363, unc-54p::Myc::daf-15 and unc-54p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.
SYS541 C. elegans daf-19(dev164([daf-19::mNeonGreen]) ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of daf-19 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS588 C. elegans ujIs113 II; daf-12(hq213([daf-12::gfp]) X. Show Description
GFP knockin at C-terminal of daf-12 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
TJ356 C. elegans zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
VC1027 C. elegans daf-15(ok1412)/nT1 IV; +/nT1 V. Show Description
C10C5.6a. Homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1412 homozygotes (arrested incomplete dauers). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1641 C. elegans daf-10(gk795) IV. Show Description
F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC243 C. elegans daf-12(ok493) X. Show Description
F11A1.3, F11A1.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VT3922 C. elegans lin-28(n719) I; daf-12(ma497[daf-12::gfp]) hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
Precocious heterochronic phenotypes as preciously reported for lin-28(n719). Endogenous daf-12 locus tagged with GFP. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
VT3923 C. elegans maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X. Show Description
maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
XE1593 C. elegans daf-16(mu86) I; wpSi14 II; daf-2(e1370) III. Show Description
wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73. doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228
ZM8874 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3371. Show Description
hpEx3371 [rgef-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9441 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3370. Show Description
hpEx3370 [dpy-30p::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic strain expressing DAF-16A isoform from pan-tissue dpy-30 promoter. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9442 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3373. Show Description
hpEx3373 [ges-1p::GFP::daf-16a::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9443 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3507. Show Description
hpEx3507 [ges-1p::GFP::daf-16d/f::unc-54 3' UTR + myo-2p::mCherry]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. Transgenic animals have GFP in gut and RFP in pharynx and will form dauers at 25C. Non-transgenic animals will not form dauers. Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.
ZM9444 C. elegans daf-16(mu86) I; daf-2(e1370) III; hpEx3508. Show Description
hpEx3508 [ges-1p::daf-16a,d&f + myo-2p::RFP]. Pick RFP+ and keep at 15C to maintain. Can be kept at 20C, but some animals will form dauers. ges-1 promoter drives expression DAF-16A,D&F transgene in intestine. Transgenic animals have RFP in pharynx and will form dauers at 25C. Non-transgenic animals are dauer-defective (Daf-d). Reference: Hung WL. et al., Development (2014) 141 (8): 1767–1779.