More Fields
Strain Species Genotype
DR240 C. elegans dpy-11(e224) unc-42(e270) daf-11(m84) V. Show Description
Temperature sensitive dauer constitutive. Dpy. Unc.
DR244 C. elegans daf-19(m86) sqt-1(e1350) II. Show Description
Temperature sensitive dauer constitutive. Many dauers at 15C. Dpy. Heterozygotes Roll.
DR245 C. elegans daf-14(m77) unc-22(m52) IV. Show Description
Temperature sensitive dauer constitutive. Dominant Twitcher
DR25 C. elegans daf-12(m25) X. Show Description
Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]
DR26 C. elegans daf-16(m26) I. Show Description
Dauer defective-leaky. Somewhat small. Suppresses daf-2.
DR27 C. elegans daf-16(m27) I. Show Description
Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.
DR411 C. elegans dpy-13(e184)/daf-15(m81) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Dpy and dauers. Dauers are lethal and SDS-sensitive. NOTE: WT recombinants that have lost dpy-13 can quickly overtake a population.
DR412 C. elegans daf-15(m81)/unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Unc, and lethal dauers. Dauers are SDS-sensitive.
DR427 C. elegans daf-12(m116) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
DR431 C. elegans daf-19(m86)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dauers and DpyUnc.
DR442 C. elegans unc-8(e49) daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Unc.
DR47 C. elegans daf-11(m47) V. Show Description
Temperature sensitive. Leaky at 25C. Dauers recover poorly at 15C. Dauers escape plates. Recessive. Chemotaxis defective (Na+). Received new stock from Riddle lab in November 2006.
DR66 C. elegans daf-13(m66) X. Show Description
SDS sensitive dauers. Non-crowder.
DR732 C. elegans daf-15(m81) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Twitchers which are dauers (dauer constitutive) and dead eggs. Maintain by picking WT. Hets twitch in 1% nicotine.
DR77 C. elegans daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.
DR86 C. elegans daf-19(m86) II. Show Description
Temperature sensitive dauer constitutive. Difficult to grow. 100% dauers at 25C. 90% dauers at 15C.
DR978 C. elegans daf-12(m419) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, and intestine. Class III allele.
DR979 C. elegans daf-12(m420) X. Show Description
daf-d. Weak heterochronic phenotypes in intestine. Class III allele.
DR980 C. elegans daf-12(m421) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
DR981 C. elegans daf-12(m422) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
DR983 C. elegans daf-12(m424) X. Show Description
daf-d. Weak heterochronic phenotypes in intestine. Class III allele.
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3525 C. elegans daf-15(re257[daf-15::mNG::AID]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
ENL62 C. elegans daf-16(mu86) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CF1038.
ENL63 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. Derived from RB1739 and GR1352.
ENL67 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.
ENL68 C. elegans sma-10(ok2224) zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.
ET507 C. elegans daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.
FK183 C. elegans daf-11(ks67) V; ksEx29. Show Description
ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.
GA132 C. elegans daf-16(mgDf50) I; daf-2(m646) III. Show Description
Maintain at 15C.
GA158 C. elegans daf-16(mgDf50) I; daf-2(m65) III. Show Description
Maintain at 15C.
GA2003 C. elegans daf-16(mgDf50) I; daf-2(e1370) III; wuIs305. Show Description
wuIs305 [myo-3p::Queen-2m]. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GR1307 C. elegans daf-16(mgDf50) I. Show Description
Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.
GR1308 C. elegans daf-16(mg54) I; daf-2(e1370) III. Show Description
mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.
GR1309 C. elegans daf-16(mgDf47) I; daf-2(e1370) III. Show Description
mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
GR1352 C. elegans daf-16(mgDf47) I; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
GR1895 C. elegans daf-2(e1370) III; mgIs67. Show Description
mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.
HGA8004 C. elegans daf-16(mu86) I; glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8005 C. elegans glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HR83 C. elegans mel-24(ct59) dpy-20(e1282)/unc-24(e138) daf-15(m81) IV. Show Description
Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.
HT1881 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1882 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs13. Show Description
lpIs13 [daf-16b::CFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1883 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1888 C. elegans daf-16(mgDf50) I; unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Over-expresses daf-16a. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
HT1889 C. elegans daf-16(mgDf50) I; unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Over-expresses daf-16f. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
HT1890 C. elegans daf-16(mgDf50) I; daf-2(e1370) III. Show Description
Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
IU10 C. elegans daf-16(mgDf47) I; rrf-3(pk1426) II. Show Description
JJ862 C. elegans hmp-1(zu278)/daf-11(m84) sma-1(e30) V. Show Description
Heterozygotes are WT and segregate WT, Hmp inviable embyros (Hmp: humpback-defective body elongation, abnormal bulges on dorsal side) and Daf Sma (ts Daf).
JJ938 C. elegans unc-24(e138) daf-14(m77)/elt-1(zu180) dpy-20(e1282) IV. Show Description
At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.