Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.

Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphid neurons with FITC.

syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Superficially wild-type. Reference: Simske J & Dong Y. (2017). International Worm Meeting. The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis. WBPaper00051789.

zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.

B0412.2 Homozygous. Maintain at 15C. Outer Left Sequence: cttccttctttccctcccac. Outer Right Sequence: ttgtgacaatcggaagtgga. Inner Left Sequence: gcttatccggatttgacgaa. Inner Right Sequence: catttcttggcgatcattcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25E2.5 Homozygous. Outer Left Sequence: ctaattgccggaatcgaaaa. Outer Right Sequence: gacacttgatggccggttac. Inner Left Sequence: cgatttgctgaatttgtgga. Inner Right Sequence: gatctttcaacgaacctacgc. Inner Primer PCR Length: 1315. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01G10.8 Homozygous. Outer Left Sequence:ccaaccgacttccttgttgt . Outer Right Sequence: attcgttcatcagccacctc. Inner Left Sequence: ggctgcggggaattatatgt. Inner Right Sequence: tccgagagccaatgttttct. Inner Primer PCR Length: 1192. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

hutSi2642 [hsp-90p::mCherry::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mCherry from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

hutSi2661 [hsp-90p::eGFPT::unc-54 3'UTR + Cbr-unc-119 (+)] II. Expresses a single copy of mEGFP from hsp-90 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. hsp-90 previously known as daf-21. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.

Hypomorphic allele. Temperature-sensitve Daf-c. Maintain at 15 C. Reference: Gerisch B, Antebi A. Development. 2004 Apr;131(8):1765-76.

stIs11523 [daf-3a::H1-wCherry + unc-119(+)].

stIs11614 [daf-16f::H1-wCherry + unc-119(+)].

stIs11691 [daf-16d::H1-wCherry + unc-119(+)].

Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

muIs84 [sod-3p::GFP + rol-6(su1006)]. Maintain at 20C. Embryonic lethal at 15C. Dauer formation at 25C. GFP should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or lower. Dauer formation at 25C. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or lower. Dauer formation at 25C. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

ncEx9005 [lin-32p::FLAG::let-363 + lin-32p::Myc::daf-15 + lin-32p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing lin-32p followed by the FLAG-, Myc- and HA-coding sequences to generate lin-32p::FLAG::let-363, lin-32p::Myc::daf-15 and lin-32p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ncEx9007 [unc-54p::FLAG::let-363 + unc-54p::Myc::daf-15 + unc-54p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing inserted into pPD30.38 containing unc-54p followed by the FLAG-, Myc- and HA-coding sequences to generate unc-54p::FLAG::let-363, unc-54p::Myc::daf-15 and unc-54p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of daf-19 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of daf-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

GFP knockin at C-terminal of daf-12 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of daf-8 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.

High frequency of dauer formation under hyperoxia (90% oxygen) at 20C. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

Hypersensitive to Paraquat. Growth arrest under hyperoxia (90% oxygen) at any larval stage. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

Daf-c. Maintain at 15C. Sensitive to hyperoxia and paraquot, comparable to mev-1(kn1) alone. High mutation rate. Extended lifespan measured after mid-adult stage is similar to daf-2(e1370) alone. High mortality rate in early adults. Reference: Honda Y, Tanaka M, Honda S. Exp Gerontol. 2008 Jun;43(6):520-9.

Egl. Not temperature sensitive -- can be grown at any temperature.

cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C.

cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9.

cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.

svIs69 [daf-28p::daf-28::GFP + unc-4(+)]. Derived from injection of pVB298gk (daf-28p::daf-28::GFP) with unc-4(+) into unc-4(e120). unc-4(e120) was likely removed during out-crossing, but might still be in background.

C10C5.6a. Homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1412 homozygotes (arrested incomplete dauers). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A1.3, F11A1.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13C5.1. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous gk160 hermaphrodites (arrested dauer-like larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.