More Fields
Strain Species Genotype
OH14989 C. elegans ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID]) X. Show Description
ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted
OH15845 C. elegans daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH15913 C. elegans daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID]) X; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted
OH16024 C. elegans daf-16(ot971[daf-16::GFP]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with GFP. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH16029 C. elegans daf-16(ot975[daf-16::mNeptune2.5::AID]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH16508 C. elegans daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OK66 C. elegans daf-4(m72) III; cuIs2/+ IV. Show Description
cuIs2 [myo-2c:: GFP + rol-6(su1006)]. daf-4(m72) is a temperature sensitive dauer constitutive mutant. Maintain at 15C. It was problematic to get cuIs2 homozygous in this background. Pick Rollers to maintain.
OK68 C. elegans cuIs2 IV; daf-3(mgDf90) X. Show Description
Dauer defective. cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers. [NOTE: this strain was originally described as carrying daf-3(mg90), which is an old name for daf-3(mgDf90).]
OP167 C. elegans unc-119(ed3) III; wgIs167. Show Description
wgIs167 [daf-12::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP790 C. elegans unc-119(tm4063) III; wgIs790. Show Description
wgIs790 [daf-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP794 C. elegans unc-119(tm4063) III; wgIs794. Show Description
wgIs794 [daf-19::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OS9422 C. elegans igdb-2(ns122) IV. Show Description
Suppresses diI dye-filling phenotype in 37% of daf-6(e1377) mutants.
PJ105 C. elegans cad-1(j1) II; daf-4(e1364) III. Show Description
Very small, almost Dpy. Temperature sensitive dauer constitutive. Many dauers at 16C. Reduced cathepsin.
PJ1132 C. elegans daf-18(e1375) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dauer defective. May make bags of worms at low frequency??
PJ1134 C. elegans ccIs55 V; pdk-1(mg142) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. No visible phenotype (may be smallish??). Dominant suppressor of daf-c phenotype of age-1.
PJ1145 C. elegans ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Slight Egl.
PJ1146 C. elegans daf-2(m41) III; ccIs55 V; pdk-1(mg142) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Gain of function allele of pdk-1.
PJ1162 C. elegans ccIs55 V; unc-1(e719) pdk-1(sa680) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc - recessive kinker. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy, and fertility defects can be rescued maternally.
PJ1166 C. elegans daf-2(m41) III; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
PJ1182 C. elegans unc-43(n498) IV; ccIs55 V; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function. Progressive paralysis.
PJ1185 C. elegans daf-5(e1386) II; daf-4(m592) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Small size and weak lacZ staining at 25C. daf-4 dauer defects are suppressed by daf-5, but not the small size.
PJ1192 C. elegans daf-1(m40) IV; iwIs16 X. Show Description
iwIs16 [act-4::lacZ] X. Maintain at 15C. Temperature-sensitive dauer constitutive. 100% dauer formation at 25C; poor dauer recovery at 15C. Maternal effect. Good lacZ expression in spermatheca, but weak in body wall.
PJ1194 C. elegans daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.
PJ1195 C. elegans daf-8(e1393) I; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.
PJ1196 C. elegans daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C. NOTE: m62 is an amber allele of daf-7, which is well suppressed by sup-7 in ccIs55 at 16C.
PJ1199 C. elegans daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Constitutive dauer formation at 25C.
PJ1228 C. elegans daf-4(m592) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Leaky dauer constitutive -- ~95% dauer formation at 25C. Small body size at 20C. Strong lacZ staining in body wall at 15C; no staining at 25C.
PJ1257 C. elegans daf-4(m592) III; unc-51(e369) ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Small. Unc. Most progeny shifted to 26C form dauers.
PJ1258 C. elegans daf-1(m213) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Most progeny shifted to 26C form dauers. Some dauer formation at 20C.
PJ1259 C. elegans daf-1(m402) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Most progeny shifted to 26C form dauers. Some dauer formation at 20C.
PJ1271 C. elegans daf-4(m592) III; ccIs55 V; daf-3(e1376) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.
PJ1272 C. elegans daf-4(m592) III; daf-18(e1375) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Abnormal-looking dauers form at 25C.
PJ1276 C. elegans daf-8(e1393) I; daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.
PJ1305 C. elegans unc-43(n498j038) IV; ccIs55; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.
PJ1700 C. elegans daf-2(m41) III; unc-51(e369) ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc -- very slow. Grows very slowly.
PR673 C. elegans hsp-90(p673) V. Show Description
Defective in chemotaxis to all attractants and to D-tryptophan; partially defective in chemotaxis to CO2(phosphate) and H+(citrate). Thermotaxis weak. p673 previously called tax-3 or daf-21.
PR821 C. elegans daf-10(p821) IV. Show Description
Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphid neurons with FITC.
PS1922 C. elegans dpy-20(e1282) syIs24 IV. Show Description
syIs24 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS2109 C. elegans dpy-20(e1282) IV; syIs25 X. Show Description
syIs25 [(pJM3QL) gpa-3(gf) + (pMH86) dpy-20(+)]. pJM3QL is a gain-of-function mutation in gpa-3 Daf-c. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS5531 C. briggsae Cbr-daf-2(sy5445). Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS8441 C. elegans daf-2 (e1370) III; glo-1(sy1306) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9391 C. briggsae syIs802 X. Show Description
syIs802[Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9392 C. briggsae syIs803 II. Show Description
syIs803 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9393 C. briggsae syIs804 X. Show Description
syIs804 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS9396 C. briggsae syIs807 IV. Show Description
syIs807 [Cel-daf-4(+) + Cel-myo-2::GFP]. May contain Cbr-daf-4(sa973) in background. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
QQ202 C. elegans daf-2(cv20[daf-2::gfp]) III. Show Description
Superficially wild-type. Reference: Simske J & Dong Y. (2017). International Worm Meeting. The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis. WBPaper00051789.
QQ253 C. elegans daf-16(mgDf50) I; daf-2(m65) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.
RAF2181 C. elegans ieSi57 II; daf-2(bch-40[degron::3xFLAG::STOP::SL2::SV40::degron::wrmScarlet::egl-13NLS]) unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into endogenous daf-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Venz R, et al. Elife. 2021 Sep 10;10:e71335. doi: 10.7554/eLife.71335. PMID: 34505574.
RB2302 C. elegans daf-7(ok3125) III. Show Description
B0412.2 Homozygous. Maintain at 15C. Outer Left Sequence: cttccttctttccctcccac. Outer Right Sequence: ttgtgacaatcggaagtgga. Inner Left Sequence: gcttatccggatttgacgaa. Inner Right Sequence: catttcttggcgatcattcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2589 C. elegans daf-3(ok3610) X. Show Description
F25E2.5 Homozygous. Outer Left Sequence: ctaattgccggaatcgaaaa. Outer Right Sequence: gacacttgatggccggttac. Inner Left Sequence: cgatttgctgaatttgtgga. Inner Right Sequence: gatctttcaacgaacctacgc. Inner Primer PCR Length: 1315. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807