More Fields
Strain Species Genotype
JJ938 C. elegans unc-24(e138) daf-14(m77)/elt-1(zu180) dpy-20(e1282) IV. Show Description
At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.
JK1438 C. elegans daf-2(m65)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, non-conditional dauers, and Sterile Dpys. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JN1239 C. elegans daf-18(pe407) IV. Show Description
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1483 C. elegans daf-18(pe407) IV. Show Description
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1484 C. elegans daf-18(pe408) IV. Show Description
pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1489 C. elegans daf-2(pe1230) III. Show Description
Daf-c phenotype at 25C; normal development at 20C. Defects in salt-starve associative learning and olfactory learning. Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN2722 C. elegans daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
JN785 C. elegans peIs785. Show Description
peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JR1763 C. elegans wcDf1 dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
At 25C, heterozygotes are WT and segregate WT, dead eggs and Dauers (which will give only dead eggs if they exit dauer). e1372 and it46 are both temperature sensitive.
JT10066 C. elegans unc-1(e719) pdk-1(sa680) X. Show Description
Unc. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy and fertility defects can be rescued maternally. Maintain at 15C.
JT10189 C. elegans daf-14(m77) IV; scd-2(sa935) V. Show Description
Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.
JT10800 C. elegans ncr-2(nr2023) III; ncr-1(nr2022) X. Show Description
Daf-c (partial dauer), vulval abnormalities, broken alae, gonadal migration defects, low brood size, short lifespan. May grow better at 15C. Strain is healthier when recovered from starved plates by chunking than when continuously propagated. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JT11323 C. elegans heh-1(ok603) III. Show Description
Cholesterol concentration-dependent Daf-c. If cholesterol is omitted from NGM, animals form dauers (no dauers are formed on regular NGM). Temperature sensitive Daf-c; heh-1 animals more readily form dauers at 27C than WT animals. Partial dauer phenotype; dauers exhibit ale but do not fully constrict pharynges nor arrest germline proliferation. On low cholesterol, vulva protrudes and sometimes ruptures; animals exhibit egg-laying defects. Hypersensititve to progesterone in culture media.
JT156 C. elegans daf-12(sa156) X. Show Description
daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.
JT191 C. elegans daf-28(sa191) V. Show Description
Temperature sensitive dauer constitutive. Highly penetrant at 25C, much less so at 20C and 15C. The dauers recover almost immediately after temperature down shift, so one may work with synchronous broods. Semi-dominant: about 10% of heterozygotes form dauers.
JT193 C. elegans daf-2(sa193) III. Show Description
Adults Age and Itt, but not Unc (class 1 allele). sa193 results in an amino acid substitution(A580T) in the extracellular portion of the DAF-2 receptor (specifically, the L2 domain).
JT204 C. elegans daf-12(sa204) X. Show Description
Lon. Daf-d.
JT6 C. elegans exp-1(sa6) II. Show Description
Exp defective. Constipated. May contain a weak daf-2 mutation (sa753). See Ailion and Thomas in Genetics 165: 127-144 2003.
JT6130 C. elegans hsp-90(p673) V. Show Description
Recessive Daf-c mutation that also causes Odr and Che defects. Maintain at 15C. [The mec-1 mutation present in the original isolates has been eliminated.] Previously known as daf-21.
JT6924 C. elegans daf-19(m86) II; daf-12(sa204) X. Show Description
Lon. Daf-d. Suppresses Daf-c phenotype of daf-19(m86). Dyf.
JT709 C. elegans pdk-1(sa709) X. Show Description
Daf-c at 27C. Weakly Egl and Clumpy. Maintain at 15C.
JT9609 C. elegans pdk-1(sa680) X. Show Description
Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy and fertility defects can be rescued maternally. Maintain at 15C.
JU486 C. elegans mfIs4. Show Description
mfIs4 [egl-17::YFP + daf-6::CFP + unc-119(+)]. YFP is expressed in the secondary vulval lineage (vulC, D) and CFP in the primary vulval lineage (vulE, F). egl-17::YFP from the pDRS17 plasmid (D. Sherwood and P. Sternberg). daf-6::CFP from the pCK1 plasmid (C. Kolditz and MA Felix). Slightly Egl, Pvl. unc-119(ed3) might still be present in the background.
KK114 C. elegans daf-7(e1372) par-2(it5) III. Show Description
Temperature sensitive-grow at 15C. Par at 25C. Strict maternal effect lethal.
KN478 C. elegans daf-16(mu86) I; huIs33. Show Description
huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.
LL1009 C. elegans hsp-90(nr2081)/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and arrested larvae. Published as LL1008. Previously known as daf-21.
LP852 C. elegans daf-2(e1370) III; lea-1(cp423[myo-2p::GFP::myo-2 3'UTR]) V. Show Description
Maintain at 15C. Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP860 C. elegans daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP861 C. elegans daf-2(e1370) III; lea-1(cp430[lea-1::mYPET::3x FLAG]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mYPET. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LRB434 C. elegans daf-18(syb1615) IV. Show Description
D137A. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(D137A) corresponds to human allele PTEN(D92A). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.
LRB435 C. elegans daf-18(syb1618) IV. Show Description
G174E. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(G174E) corresponds to human allele PTEN(G129E). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.
LRB436 C. elegans daf-18(syb1516) IV. Show Description
C169S. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(C169S) corresponds to human allele PTEN(C124S). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.
LV15 C. elegans unc-45(st601)/daf-7(e1372) par-2(it46) III. Show Description
st601 is a non-conditional two-fold arrest lethal. Maintain at 25C to see daf-7 par-2 segregants (Daf-7(+) escapers will be Par). WT heterozygotes segregate WT, DafPar, 1/4 lethal eggs and two-fold arrest hatchlings. [3/97: dauers are not giving dead eggs-they are giving more dauers. The par-2 mutation may be lost.]
LV18 C. elegans unc-45(wc1) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]
LV19 C. elegans unc-45(wc2) dpy-1(e1)/daf-7(e1372) par-2(it46) III. Show Description
Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]
MAH14 C. elegans daf-2(e1370) III; adIs2122. Show Description
adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Maintain at 15C. ~30% animals form dauers at 20C. Not all animals will roll, but all should be GFP+. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.
MAH20 C. elegans daf-16(mu86) I; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
MAH50 C. elegans daf-16(mu86) I; glp-1(e2141) III; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
MAH97 C. elegans rrf-1(pk1417) I; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
MH4810 C. elegans elt-1(ku491) IV; wIs51 V; daf-12(rh61rh411) X; kuEx194. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.
MH5015 C. elegans kuIs118 II; unc-119(ed3) III. Show Description
kuIs118 [daf-15p::daf-15::mCherry + Cbr-unc-119(+)] II. kuIs118 is a single copy insertion into ttTi5605 via CRISPR/Cas9. Superficially wild-type. mCherry expression observed throughout the body. mCherry detected throughout development by western blot with anti-mCherry antibody, with highest expression levels in early larval stages. Reference: Sewell AK, et al. "The TORC1 phosphoproteome in C. elegans reveals roles in transcription and autophagy” iScience, 20 May 2022, 104186. https://www.sciencedirect.com/science/article/pii/S2589004222004564.
MQ1050 C. elegans daf-16(m26) I; isp-1(qm150) IV. Show Description
Slow development.
MQ415 C. elegans age-1(hx546) rrf-3(b26) II; gro-1(e2400) III. Show Description
Slow growing. Not fertile at 25C. Daf-c at 27C.
MQ513 C. elegans daf-2(e1370) clk-1(e2519) III. Show Description
Daf-c at 25C. Slower growing than clk-1(e2519).
MQD1543 C. elegans daf-16(hq23[daf-16::GFP]) I. Show Description
GFP tag inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. The GFP fusion tag does not interfere with the function of DAF-16 protein. DAF-16::GFP is expressed ubiquitously in most or all somatic tissues, including neurons, intestine, body wall muscles, and hypodermis, and also in the germ cells and oocytes. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD1661 C. elegans daf-2(hq61[daf-2::mNeongreen]) III. Show Description
mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. Phenotypic assays have shown that this mNeonGreen tag does not perturb the function of the DAF-2 protein. DAF-2::mNeonGreen is expressed in neurons, XXX cells, vulval cells, germ cells, and oocytes with clear plasma membrane localization as expected for a cell surface receptor. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD1779 C. elegans daf-2(hq63[daf-2::ICR::NLS::gfp::mNeonGreen::NLS]) III. Show Description
Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2356 C. elegans hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3’UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2374 C. elegans ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2375 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.