lpIs12 [daf-16a::RFP + unc-119(+)]. Over-expresses daf-16a. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.

lpIs14 [daf-16f::GFP + unc-119(+)]. Over-expresses daf-16f. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.

Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.

wwEx85 [daf-28p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

Heterozygotes are WT and segregate WT, Hmp inviable embyros (Hmp: humpback-defective body elongation, abnormal bulges on dorsal side) and Daf Sma (ts Daf).

At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.

Heterozygotes are WT and segregate WT, non-conditional dauers, and Sterile Dpys. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

Daf-c phenotype at 25C; normal development at 20C. Defects in salt-starve associative learning and olfactory learning. Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047

peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602

At 25C, heterozygotes are WT and segregate WT, dead eggs and Dauers (which will give only dead eggs if they exit dauer). e1372 and it46 are both temperature sensitive.

Unc. Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy and fertility defects can be rescued maternally. Maintain at 15C.

Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.

Daf-c (partial dauer), vulval abnormalities, broken alae, gonadal migration defects, low brood size, short lifespan. May grow better at 15C. Strain is healthier when recovered from starved plates by chunking than when continuously propagated. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Cholesterol concentration-dependent Daf-c. If cholesterol is omitted from NGM, animals form dauers (no dauers are formed on regular NGM). Temperature sensitive Daf-c; heh-1 animals more readily form dauers at 27C than WT animals. Partial dauer phenotype; dauers exhibit ale but do not fully constrict pharynges nor arrest germline proliferation. On low cholesterol, vulva protrudes and sometimes ruptures; animals exhibit egg-laying defects. Hypersensititve to progesterone in culture media.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

Temperature sensitive dauer constitutive. Highly penetrant at 25C, much less so at 20C and 15C. The dauers recover almost immediately after temperature down shift, so one may work with synchronous broods. Semi-dominant: about 10% of heterozygotes form dauers.

Adults Age and Itt, but not Unc (class 1 allele). sa193 results in an amino acid substitution(A580T) in the extracellular portion of the DAF-2 receptor (specifically, the L2 domain).

Lon. Daf-d.

Exp defective. Constipated. May contain a weak daf-2 mutation (sa753). See Ailion and Thomas in Genetics 165: 127-144 2003.

Recessive Daf-c mutation that also causes Odr and Che defects. Maintain at 15C. [The mec-1 mutation present in the original isolates has been eliminated.] Previously known as daf-21.

Lon. Daf-d. Suppresses Daf-c phenotype of daf-19(m86). Dyf.

Daf-c at 27C. Weakly Egl and Clumpy. Maintain at 15C.

Daf-c at 25C. Egl, Clumpy, Lon, low brood size. Dauers do not recover when moved to 15C in the presence of food. Daf-c, Lon, Clumpy and fertility defects can be rescued maternally. Maintain at 15C.

mfIs4 [egl-17::YFP + daf-6::CFP + unc-119(+)]. YFP is expressed in the secondary vulval lineage (vulC, D) and CFP in the primary vulval lineage (vulE, F). egl-17::YFP from the pDRS17 plasmid (D. Sherwood and P. Sternberg). daf-6::CFP from the pCK1 plasmid (C. Kolditz and MA Felix). Slightly Egl, Pvl. unc-119(ed3) might still be present in the background.

Temperature sensitive-grow at 15C. Par at 25C. Strict maternal effect lethal.

huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.

Heterozygotes are Unc and segregate Unc, dead eggs and arrested larvae. Published as LL1008. Previously known as daf-21.

Maintain at 15C. Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

Endogenous LEA-1 tagged at the C-terminus with mYPET. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234

D137A. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(D137A) corresponds to human allele PTEN(D92A). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.

G174E. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(G174E) corresponds to human allele PTEN(G129E). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.

C169S. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(C169S) corresponds to human allele PTEN(C124S). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.

st601 is a non-conditional two-fold arrest lethal. Maintain at 25C to see daf-7 par-2 segregants (Daf-7(+) escapers will be Par). WT heterozygotes segregate WT, DafPar, 1/4 lethal eggs and two-fold arrest hatchlings. [3/97: dauers are not giving dead eggs-they are giving more dauers. The par-2 mutation may be lost.]

Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (dauer escapers will be Par and give only dead eggs), and DpyUcs which arrest as dead eggs (range from twitching multicellulars to 3-folds that hatch). [There is a greater percentage of hatchlings when the mother is heterozygous (wc1 dpy-1/+). There may also be the possibility of near complete maternal rescue (near full-sized, sterile Dpys), but this has not been routinely observed in the balanced strain (as opposed to wc1 dpy-1/+).] Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: The dauers are not giving dead eggs-they are giving other dauers. Appears that the Par mutation is no longer present.]

Maintain at 25C. At 25C, heterozygotes are WT and segregate WT, Dauers (escapers will be Par and give only dead eggs) and DpyUncs which are dead eggs (a range of embryonic lethality from multicellular twitchers to 3-folds that do not hatch). Maintain by picking WT at 25C and scoring for correct segregation of progeny. [3/97: the dauers are giving dead eggs.]

adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Maintain at 15C. ~30% animals form dauers at 20C. Not all animals will roll, but all should be GFP+. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

wIs51 [SCMp::GFP + unc-119(+)] V. kuEx194 [elt-1(+) + sur-5p::DsRed]. GFP expression in seam cells. Pick DsRed+ animals to maintain. In a daf-12(WT) background, elt-1(ku491) exhibits some precocious fusion of seamcells and gaps in alae. elt-1(ku491); daf-12(rh61rh411) double mutants have more sever heterochronic phenotypes including seamcell proliferation and bursting vulvae. Reference: Cohen ML, et al. PLoS Genet. 2015 Mar 27;11(3):e1005099.

kuIs118 [daf-15p::daf-15::mCherry + Cbr-unc-119(+)] II. kuIs118 is a single copy insertion into ttTi5605 via CRISPR/Cas9. Superficially wild-type. mCherry expression observed throughout the body. mCherry detected throughout development by western blot with anti-mCherry antibody, with highest expression levels in early larval stages. Reference: Sewell AK, et al. "The TORC1 phosphoproteome in C. elegans reveals roles in transcription and autophagy” iScience, 20 May 2022, 104186. https://www.sciencedirect.com/science/article/pii/S2589004222004564.

Slow development.

Slow growing. Not fertile at 25C. Daf-c at 27C.

Daf-c at 25C. Slower growing than clk-1(e2519).