More Fields
Strain Species Genotype
ENL20 C. elegans mir-80(nDf53) III; daf-1(m213) mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
ENL21 C. elegans daf-2(e1370) mir-80(nDf53) III; mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive (daf-c).
ENL54 C. elegans daf-2(e1370) III; mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
ENL55 C. elegans daf-2(e1370) mir-80(nDf53) III; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
ENL62 C. elegans daf-16(mu86) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CF1038.
ENL63 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. Derived from RB1739 and GR1352.
ENL67 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.
ENL68 C. elegans sma-10(ok2224) zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.
ENL70 C. elegans daf-2(e1370) III; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CB1370.
ET507 C. elegans daf-16(mu86) I; cki-2(ok2105) II; glp-1(ar202) III. Show Description
Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.
FK163 C. elegans cam-1(ks52) II. Show Description
Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.
FK181 C. elegans ksIs2. Show Description
ksIs2 [daf-7p::GFP + rol-6(su1006)]. Rollers.
FK183 C. elegans daf-11(ks67) V; ksEx29. Show Description
ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.
GA132 C. elegans daf-16(mgDf50) I; daf-2(m646) III. Show Description
Maintain at 15C.
GA158 C. elegans daf-16(mgDf50) I; daf-2(m65) III. Show Description
Maintain at 15C.
GA2002 C. elegans daf-2(e1370) III; wuIs305. Show Description
wuIs305 [myo-3p::Queen-2m]. Temperature sensitive dauer constitutive. Maintain at 15C. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.
GA2003 C. elegans daf-16(mgDf50) I; daf-2(e1370) III; wuIs305. Show Description
wuIs305 [myo-3p::Queen-2m]. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GR1032 C. elegans age-1(mg44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).
GR1307 C. elegans daf-16(mgDf50) I. Show Description
Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.
GR1308 C. elegans daf-16(mg54) I; daf-2(e1370) III. Show Description
mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.
GR1309 C. elegans daf-16(mgDf47) I; daf-2(e1370) III. Show Description
mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
GR1310 C. elegans akt-1(mg144) V. Show Description
No visible phenotype. Dominant suppressor of daf-c phenotype of age-1.
GR1311 C. elegans daf-3(mgDf90) X. Show Description
mgDf90 completely eliminates the daf-3 coding region.
GR1318 C. elegans pdk-1(mg142) X. Show Description
No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.
GR1336 C. elegans daf-2(e1370) III; njEx32. Show Description
njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1337 C. elegans daf-2(e1370) III; njEx38. Show Description
njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1339 C. elegans daf-2(e1370) III; mgEx376. Show Description
mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1340 C. elegans daf-2(e1370) III; mgEx373. Show Description
mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1352 C. elegans daf-16(mgDf47) I; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
GR1455 C. elegans mgIs40. Show Description
mgIs40 [daf-28p::GFP].
GR1895 C. elegans daf-2(e1370) III; mgIs67. Show Description
mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.
GR2107 C. elegans daf-2(e1370) III; mgEx371. Show Description
mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR2117 C. elegans daf-2(e1365) III; mgIs35. Show Description
mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.
GR2118 C. elegans daf-9(e1406) dpy-7(sc27) X; mgEx663. Show Description
mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86.
GS3754 C. elegans sel-13(ok303) III; arIs51 IV; sel-7(n1253) unc-3(e151) X. Show Description
arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HGA8004 C. elegans daf-16(mu86) I; glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8005 C. elegans glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8012 C. elegans glp-1(e2141) III; daf-9(rh50) X; lynEx1. Show Description
lynEx1 [nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 15-20C. Temperature-sensitve Daf-c. Mig. Pick DsRed+ animals to maintain. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HR767 C. elegans daf-8(e1393) mel-26(ct61sb4) I. Show Description
ct61 is a dominant, temperature sensitive, maternal effect lethal. sb4 is a revertant of the dominant phenotype. sb4 is a recessive, temperature sensitive, maternal effect lethal with approx. 10% hatching at 15C and 0% at 25C.
HR83 C. elegans mel-24(ct59) dpy-20(e1282)/unc-24(e138) daf-15(m81) IV. Show Description
Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.
HT1881 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1882 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs13. Show Description
lpIs13 [daf-16b::CFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1883 C. elegans daf-16(mgDf50) I; daf-2(e1370) unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.
HT1888 C. elegans daf-16(mgDf50) I; unc-119(ed3) III; lpIs12. Show Description
lpIs12 [daf-16a::RFP + unc-119(+)]. Over-expresses daf-16a. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
HT1889 C. elegans daf-16(mgDf50) I; unc-119(ed3) III; lpIs14. Show Description
lpIs14 [daf-16f::GFP + unc-119(+)]. Over-expresses daf-16f. Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
HT1890 C. elegans daf-16(mgDf50) I; daf-2(e1370) III. Show Description
Short-lived. Dauer-defective (Daf-d). Maintain under standard conditions. Reference: Kwon ES, et al. Nature. 2010 Jul 22;466(7305):498-502.
HT2099 C. elegans unc-119(ed3) III; wwEx85. Show Description
wwEx85 [daf-28p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.
IU10 C. elegans daf-16(mgDf47) I; rrf-3(pk1426) II. Show Description
JJ862 C. elegans hmp-1(zu278)/daf-11(m84) sma-1(e30) V. Show Description
Heterozygotes are WT and segregate WT, Hmp inviable embyros (Hmp: humpback-defective body elongation, abnormal bulges on dorsal side) and Daf Sma (ts Daf).