daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

daf-d. Weak heterochronic phenotypes in intestine. Class III allele.

mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.

mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.

Maintain at 15C. Temperature-sensitive dauer constitutive.

Maintain at 15C. Temperature-sensitive dauer constitutive (daf-c).

Maintain at 15C. Temperature-sensitive dauer constitutive.

Maintain at 15C. Temperature-sensitive dauer constitutive.

Derived from RB1739 and CF1038.

xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. Derived from RB1739 and GR1352.

muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.

Derived from RB1739 and CB1370.

Temperature-sensitive. Maintain at 15C. Animals form germline tumors that prevent fertility at restrictive temerature (25C). This is the first strain reported to be used for the isolation of germ cells for in vitro culture. This strain allows germ cells to remain viable for longer periods than other tumorous mutant strains tested. Reference: Chaudhari SH, et al. Dev Cell. 2016 Jul 11;38(1):33-46.

Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.

ksIs2 [daf-7p::GFP + rol-6(su1006)]. Rollers.

ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.

Maintain at 15C.

Maintain at 15C.

wuIs305 [myo-3p::Queen-2m]. Temperature sensitive dauer constitutive. Maintain at 15C. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.

wuIs305 [myo-3p::Queen-2m]. ATP sensor Queen-2m is expressed under the control of myo-3 promoter. Reference: Galimov et al. Cell Rep. 2018 Mar 6;22(10):2730-2741.

Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.

Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).

Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.

mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.

mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.

No visible phenotype. Dominant suppressor of daf-c phenotype of age-1.

mgDf90 completely eliminates the daf-3 coding region.

No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.

njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).

mgIs40 [daf-28p::GFP].

mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.

mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgIs35 [ins-1(genomic) + mec-7p::GFP]. Temperature-sensitive. Maintain at 15C. Daf-c. High penetrance of dauer formation at 20C. Integration of mgEx557. Reference: Pierce SB, et al. Genes Dev. 2001 Mar 15;15(6):672-86.

mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86.

arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

lynEx1 [nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 15-20C. Temperature-sensitve Daf-c. Mig. Pick DsRed+ animals to maintain. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

ct61 is a dominant, temperature sensitive, maternal effect lethal. sb4 is a revertant of the dominant phenotype. sb4 is a recessive, temperature sensitive, maternal effect lethal with approx. 10% hatching at 15C and 0% at 25C.

Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.

lpIs12 [daf-16a::RFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.

lpIs13 [daf-16b::CFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.

lpIs14 [daf-16f::GFP + unc-119(+)]. Maintain at 15C. Extended lifespan. Reference: Kwon ES, et al., Nature. 2010 Jul 22;466(7305):498-502.