More Fields
Strain Species Genotype
TG1868 C. elegans slx-1(tm2644) I. Show Description
Reference: Agostinho A, et al. PLos Genetics 2013.
TG1878 C. elegans mus-81(tm1937) slx-1(tm2644) I. Show Description
Reference: Agostinho A, et al. PLos Genetics 2013.
TG2367 C. elegans unc-119(ed3) III; gtIs2367/+. Show Description
gtIs2367 [pie-1p::GFP(lap)::orc-5 + unc-119(+)]. Maintain by picking non-Unc. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
TG2368 C. elegans unc-119(ed3) III; ltIs37 IV; gtIs2368. Show Description
gtIs2368 [pie-1p::GFP(lap)::rpa-1 + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Sonneville R, et al. J Cell Biol. 2012 Jan 23;196(2):233-46.
TG2394 C. elegans cat-2(e1112) II; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
TG2401 C. elegans dat-1(ok157) III; vtIs1 V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Many animals roll weakly or not at all, but still express GFP. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
TG2411 C. elegans vtIs1 dop-2(vs105) V; tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
TG2415 C. elegans vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
TG2416 C. elegans vtIs1 dop-2(vs105) V; dop-1(vs100) dop-3(vs106) tsp-17(gt1681) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
TG2437 C. elegans vtIs1 V; tsp-17(tm5169) X. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.
TG3967 C. elegans bub-3(ok3437) II Show Description
Y54G9A.6. IR sensitive. To genotype: External left primer: GTCCCGTTTCCCCCATTTG. External right primer: CTCTTCATCATCTCCTCTCC. Internal right primer: CTCCTCCGAACGCTACTT. External WT amplicon: 1970 bp. External mutant amplicon: 1635 bp. Internal WT amplicon: 1534 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885. Kim T, et al. J Cell Biol. 2015 May 25;209(4):507-17.
TG3969 C. elegans san-1(ok1580) I. Show Description
ZC328.4. IR sensitive. External left primer: AACAAGAAGGGGAAGAAAGA. External right primer: TGTCTCATCGAAATCCAACT. Internal Left Sequence: AGGAAGAAACGAGAAAAGCA. External WT amplicon: 1420 bp. External mutant amplicon: 428 bp. Internal WT amplicon: 720 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
TG4281 C. elegans unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al. https://www.biorxiv.org/content/early/2017/10/13/198606.
TH11 C. elegans unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
TH26 C. elegans unc-119(ed3) III; ddEx10. Show Description
ddEx10 [pie-1p::GFP::sas-4 + unc-119(+)]. Maintain by picking non-Unc.
TH27 C. elegans unc-119(ed3) III; ddIs6 V. Show Description
ddIs6 [tbg-1::GFP + unc-119(+)] V.
TH32 C. elegans unc-119(ed3) ruIs32 III; ddIs6 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V.
TH37 C. elegans dpy-11(e224) unc-23(e25) V. Show Description
Dpy. Unc.
TH48 C. elegans mbk-2(dd5) IV. Show Description
Recessive temperature sensitive maternal effect lethal. Maintain at 15C. At 16C: dd5 animals produce 90% viable embryos. At 20C: dd5 animals produce 56% viable embryos. At 25C: dd5 animals produce 2% viable embryos.
TH61 C. elegans unc-119(ed3) III; ddIs36. Show Description
ddIs36 [pie-1p::GFP::sas-5 + unc-119(+)].
TH65 C. elegans unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
TJ1 C. elegans cep-1(gk138) I. Show Description
F52B5.5. URL: http://www.celeganskoconsortium.omrf.org.
TJ1047 C. elegans unc-4(e120) emb-27(g48) II. Show Description
Unc. Temperature sensitive. Maintain at 15C.
TJ1049 C. elegans dpy-10(e128) emb-27(g48) II. Show Description
Temperature sensitive. Dpy.
TJ1052 C. elegans age-1(hx546) II. Show Description
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
TJ1060 C. elegans spe-9(hc88) I; rrf-3(b26) II. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ1061 C. elegans spe-9(hc88) I; emb-27(g48) II. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ1062 C. elegans spe-9(hc88) I; rrf-3(b26) age-1(hx542) II. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00002184.
TJ550 C. elegans spe-9(hc88) I; rrf-3(b26) II; gpIs1. Show Description
gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Temperature sensitive. Maintain at 15C.
TK22 C. elegans mev-1(kn1) III. Show Description
Methylviologen (paraquat) sensitive. Oxygen sensitive. Short life span.
TK66 C. elegans mev-3(kn10) I. Show Description
Methylviologen (paraquat)-resistant. Oxygen sensitive.
TK93 C. elegans mev-2(kn2) X. Show Description
Methyviologen (paraquat) hypersensitive.
TN101 C. elegans cha-1(cn101) IV. Show Description
TN64 C. elegans dpy-10(cn64) II. Show Description
Temperature sensitive. Dpy when grown at 15C. DpyRoller when grown at 25C. Heterozygotes are Rollers at any temperature.
TOG2 C. elegans T09F3.2(ogr2) II. Show Description
Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt
TP7 C. elegans phy-3(ok199) V. Show Description
WT. Deletion mutant in T20B3.7. Deletion is 1241 bp (T20B3 25891-27132). phy-3.
TQ1828 C. elegans pde-1(nj57) pde-5(nj49) I; pde-3(nj59) II; pde-2(tm3098) III. Show Description
Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.
TQ194 C. elegans trp-2(sy691) III. Show Description
TQ225 C. elegans trp-1(sy690) III. Show Description
TQ296 C. elegans trp-4(sy695) I. Show Description
TR1324 C. elegans smg-5(r860) unc-54(r293) I. Show Description
P-Vul.
TR1331 C. elegans smg-1(r861) I. Show Description
TR1335 C. elegans smg-5(r860) I. Show Description
Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.
TR1336 C. elegans smg-6(r896) III. Show Description
Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.
TR1417 C. elegans smg-1(r904) unc-54(r293) I. Show Description
P-vul.
TR1421 C. elegans smg-2(r908) unc-54(r293) I. Show Description
P-Vul.
TR1696 C. elegans unc-54(r293) I; smg-3(r930) IV. Show Description
P-vul.
TR2170 C. elegans unc-68(r1161) V. Show Description
Homozygous viable Unc. Males do not mate.
TR2171 C. elegans unc-68(r1162) V. Show Description
Homozygous viable Unc. Males do not mate.
TR2192 C. elegans unc-54(r293) I; smg-4(r1169) V. Show Description
P-vul. WT movement.