| UF65 |
C. elegans |
muIs32 II; gqIs25. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. gqIs25 [rab-3p::ppk-1 + lin-15(+)].
|
|
| UL1423 |
C. elegans |
unc-119(ed3) III; leEx1423. Show Description
leEx1423 [mxl-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UL1432 |
C. elegans |
unc-119(ed3) III; leEx1432. Show Description
leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UL1439 |
C. elegans |
unc-119(ed3) III; leEx1439. Show Description
leEx1439 [mxl-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UL1444 |
C. elegans |
unc-119(ed3) III; leEx1444. Show Description
leEx1444 [hlh-29::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UL1546 |
C. elegans |
unc-119(ed3) III; leEx1546. Show Description
leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UL1566 |
C. elegans |
unc-119(ed3) III; leEx1566. Show Description
leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UL1713 |
C. elegans |
unc-119(ed3) III; leEx1713. Show Description
leEx1713 [hlh-17::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| UP1135 |
C. elegans |
csEx52. Show Description
csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.
|
|
| UP1136 |
C. elegans |
csEx53. Show Description
csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.
|
|
| UP233 |
C. elegans |
eor-1(cs28) IV. Show Description
Deletion allele. Mildly Unc, low percentage larval lethal, low percentage Egl.
|
|
| UP533 |
C. elegans |
eor-2(cs42) X. Show Description
Nonsense allele. Mildly Unc, low percentage larval lethal, low percentage Egl.
|
|
| UT1306 |
C. elegans |
akt-1(mm200) V. Show Description
Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.
|
|
| UTK1 |
C. elegans |
utkIs1. Show Description
utkIs1 [mbr-1p::GFP + rol-6(su1006)]. Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
|
|
| UTK11 |
C. elegans |
soc-1(n1789) V; mbr-1(qa5901) X; utkEx6. Show Description
utkEx6 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK12 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X: utkEx7. Show Description
utkEx7 [mbr-1p::GFP + cwn-1p(1.4kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK13 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx8. Show Description
utkEx8 [mbr-1p::GFP + cwn-1p(0.7kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK14 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx9. Show Description
utkEx9 [mbr-1p::GFP + cwn-1p(170bp)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK15 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx10. Show Description
utkEx10 [mbr-1p::GFP + cwn-2p(4.0kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK16 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx11. Show Description
utkEx11 [mbr-1p::GFP + cwn-2p(2.1kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK17 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx12. Show Description
utkEx12 [mbr-1p::GFP + cwn-2p(0.8kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK18 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx13. Show Description
utkEx13 [mbr-1p::GFP + H20::cwn-1 + H20::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK19 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx14. Show Description
utkEx14 [mbr-1p::GFP + cwn-1p(1.8kb)::cwn-1 + rol-6(su1006)]. Rollers.
|
|
| UTK2 |
C. elegans |
mbr-1(qa5901) X. Show Description
Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.
|
|
| UTK20 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X; utkEx15. Show Description
utkEx15 [mbr-1p::GFP + cwn-1p(5.8kb)::cwn-2 + rol-6(su1006)]. Rollers.
|
|
| UTK21 |
C. elegans |
vang-1(ok1142) mbr-1(qa5901) X. Show Description
|
|
| UTK3 |
C. elegans |
cam-1(ak37) II; mbr-1(qa5901) X; utkEx2. Show Description
utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK4 |
C. elegans |
cam-1(gm122) II; mbr-1(qa5901) X. Show Description
|
|
| UTK5 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X. Show Description
|
|
| UTK6 |
C. elegans |
cwn-1(ok546) II; mbr-1(qa5901) X. Show Description
|
|
| UTK7 |
C. elegans |
cwn-2(ok895) IV; mbr-1(qa5901) X. Show Description
|
|
| UTK8 |
C. elegans |
cam-1(gm122) cwn-1(ok546) II; mbr-1(qa5901) X; utkEx3. Show Description
utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK9 |
C. elegans |
cam-1(gm122) II; cwn-2(ok895) IV; mbr-1(qa5901) X;utkEx4. Show Description
utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UV21 |
C. elegans |
him-19(jf6) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
|
|
| UV26 |
C. elegans |
him-19(tm3538) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
|
|
| UV7 |
C. elegans |
unc-119(ed3) III; jfIs2. Show Description
jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.
|
|
| VB1050 |
C. elegans |
maa-1(sv37) III. Show Description
|
|
| VB1336 |
C. elegans |
nnt-1(tm358) X. Show Description
Sensitive to oxidative stress.
|
|
| VB674 |
C. elegans |
nnt-1(sv34) X. Show Description
Sensitive to oxidative stress.
|
|
| VC3622 |
C. elegans |
T26A5.8(gk3858) III. Show Description
Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.
|
|
| VF2 |
C. elegans |
pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VH725 |
C. elegans |
pha-1(e2123) III; hdEx231. Show Description
hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.
|
|
| VJ317 |
C. elegans |
erm-1(tm677) I; sDp2 (I;f). Show Description
Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
|
|
| VK1104 |
C. elegans |
vkEx1104. Show Description
vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1241 |
C. elegans |
vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1260 |
C. elegans |
vkEx1260. Show Description
vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1870 |
C. elegans |
vkEx1870. Show Description
vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1879 |
C. elegans |
vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1984 |
C. elegans |
unc-51(e369) V; vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK689 |
C. elegans |
vkIs689. Show Description
vkIs689 [nhx-2p::sGFP::ATM + myo-2p::mCherry]. Diffuse GFP expression in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|