| UTK21 |
C. elegans |
vang-1(ok1142) mbr-1(qa5901) X. Show Description
|
|
| UTK3 |
C. elegans |
cam-1(ak37) II; mbr-1(qa5901) X; utkEx2. Show Description
utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK4 |
C. elegans |
cam-1(gm122) II; mbr-1(qa5901) X. Show Description
|
|
| UTK5 |
C. elegans |
cwn-1(ok546) II; cwn-2(ok895) IV; mbr-1(qa5901) X. Show Description
|
|
| UTK6 |
C. elegans |
cwn-1(ok546) II; mbr-1(qa5901) X. Show Description
|
|
| UTK7 |
C. elegans |
cwn-2(ok895) IV; mbr-1(qa5901) X. Show Description
|
|
| UTK8 |
C. elegans |
cam-1(gm122) cwn-1(ok546) II; mbr-1(qa5901) X; utkEx3. Show Description
utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UTK9 |
C. elegans |
cam-1(gm122) II; cwn-2(ok895) IV; mbr-1(qa5901) X;utkEx4. Show Description
utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.
|
|
| UV21 |
C. elegans |
him-19(jf6) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
|
|
| UV26 |
C. elegans |
him-19(tm3538) I. Show Description
Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.
|
|
| UV7 |
C. elegans |
unc-119(ed3) III; jfIs2. Show Description
jfIs2[pie-promoter::GFP::zhp-3 + unc-119(+)]. Maintain at 15C.
|
|
| VB1050 |
C. elegans |
maa-1(sv37) III. Show Description
|
|
| VB1336 |
C. elegans |
nnt-1(tm358) X. Show Description
Sensitive to oxidative stress.
|
|
| VB674 |
C. elegans |
nnt-1(sv34) X. Show Description
Sensitive to oxidative stress.
|
|
| VC3622 |
C. elegans |
T26A5.8(gk3858) III. Show Description
Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.
|
|
| VF2 |
C. elegans |
pcs-1(tm1748) II. Show Description
Hypersensitive to cadmium. Maintain under normal conditions. 588 bp deletion + 3 bp insertion [36918/36919 - AAA - 37506/37507]. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
|
|
| VH725 |
C. elegans |
pha-1(e2123) III; hdEx231. Show Description
hdEx231 [C16C10.10::GFP + pha-1(+)]. Ubiquitous expression of glyoxalase-1::GFP. Maintain at 25 C. Reference: Morcos M et al. (2008) Aging Cell 7(2):260-9.
|
|
| VJ317 |
C. elegans |
erm-1(tm677) I; sDp2 (I;f). Show Description
Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
|
|
| VK1104 |
C. elegans |
vkEx1104. Show Description
vkEx1104 [nhx-2p::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1241 |
C. elegans |
vkEx1241. Show Description
vkEx1241 [nhx-2p::mCherry::lgg-1 + myo-2p::GFP]. Diffuse mCherry expression in intestine. GFP+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1260 |
C. elegans |
vkEx1260. Show Description
vkEx1260 [nhx-2p::cpl-1::YFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1870 |
C. elegans |
vkEx1870. Show Description
vkEx1870 [nhx-2p::F13D12.6(G166R)::YFP + myo-2p::mCherry]. YFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1879 |
C. elegans |
vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK1984 |
C. elegans |
unc-51(e369) V; vkEx1879. Show Description
vkEx1879 [nhx-2p::cpl-1(W32A Y35A)::YFP + myo-2p::mCherry]. YFP+ accumulation in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK689 |
C. elegans |
vkIs689. Show Description
vkIs689 [nhx-2p::sGFP::ATM + myo-2p::mCherry]. Diffuse GFP expression in intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK694 |
C. elegans |
vkIs694. Show Description
vkIs694 [nhx-2p::sGFP::ATZ + myo-2p::mCherry]. GFP+ intestine. mCherry+ pharynx. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VK737 |
C. elegans |
vkEx737. Show Description
vkEx737 [hsp-4p::GFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.
|
|
| VL10 |
C. elegans |
unc-119(ed3) III; wwEx41. Show Description
wwEx41 [hlh-13::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL1176 |
C. elegans |
alh-8(ww48) II. Show Description
Partial lethality on low B12 diet; supplemental vitamin B12 is helpful. Reference: Watson E, et al. Elife. 2016 Jul 6;5.
|
|
| VL12 |
C. elegans |
unc-119(ed3) III; wwEx42. Show Description
wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL13 |
C. elegans |
unc-119(ed3) III; wwEx43. Show Description
wwEx43 [hlh-27::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL148 |
C. elegans |
unc-119(ed3) III; wwEx23. Show Description
wwEx23 [mir-270p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL187 |
C. elegans |
unc-119(ed3) III; wwEx20. Show Description
wwEx20 [mir-245p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL188 |
C. elegans |
unc-119(ed3) III; wwEx26. Show Description
wwEx26 [mir-42-44p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL19 |
C. elegans |
unc-119(ed3) III; wwEx44. Show Description
wwEx44 [hlh-33::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL2 |
C. elegans |
unc-119(ed3) III; wwEx35. Show Description
wwEx35 [hlh-16::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL205 |
C. elegans |
unc-119(ed3) III; wwEx28. Show Description
wwEx28 [mir-72p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL211 |
C. elegans |
unc-119(ed3) III; wwEx18. Show Description
wwEx18 [mir-227-80p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL23 |
C. elegans |
wwEx12. Show Description
wwEx12[ZC204.12::GFP + rol-6(su1006)]. Maintain by picking Rollers.
|
|
| VL3 |
C. elegans |
unc-119(ed3) III; wwEx36. Show Description
wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL30 |
C. elegans |
unc-119(ed3) III; wwEx45. Show Description
wwEx45 [unc-3::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL33 |
C. elegans |
unc-119(ed3) III; wwEx46. Show Description
wwEx46 [lin-22::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL347 |
C. elegans |
unc-119(ed3) III; wwEx19. Show Description
wwEx19 [mir-230p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL353 |
C. elegans |
unc-119(ed3) III; wwEx30. Show Description
wwEx30 [mir-57p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL396 |
C. elegans |
unc-119(ed3) III; wwEx29. Show Description
wwEx29 [mir-83p::GFP + unc-119(+)]. Maintain by picking WT.
|
|
| VL397 |
C. elegans |
unc-119(ed3) III; wwEx31. Show Description
wwEx31 [mir-268p::GFP + unc-119(+)]. Maintain by picking WT.
|
|
| VL4 |
C. elegans |
unc-119(ed3) III; wwEx37. Show Description
wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
|
|
| VL419 |
C. elegans |
unc-119(ed3) III; wwEx24. Show Description
wwEx24 [mir-355p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL429 |
C. elegans |
unc-119(ed3) III; wwEx25. Show Description
wwEx25 [mir-359p::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| VL43 |
C. elegans |
unc-119(ed3) III; wwIs1. Show Description
wwIs1[mdl-1::GFP + unc-119(+)]. Worms are non-Unc.
|
|