AUM1695 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I. Show Description
V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM1747 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM1760 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz151[D583A]) I. Show Description
Inactive RNase mutation of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM1787 |
C. elegans |
cosa-1(viz154[GFP::cosa-1]) III. Show Description
GFP tag inserted at N-terminus of endogenous cosa-1 locus. Expressed primarily in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM1811 |
C. elegans |
plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM1830 |
C. elegans |
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|
AUM1863 |
C. elegans |
sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|
AUM1870 |
C. elegans |
ZK813.1(viz166[fln-1p::ZK813.1]) X. Show Description
The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544.
doi: 10.1016/j.celrep.2023.112544. PMID: 37227820.
.
|
|
AUM1880 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM2023 |
C. elegans |
daf-2(e1370) unc-119(ed3) III; vizIs23. Show Description
vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40.
|
|
AUM2059 |
C. elegans |
vizSi20 II; unc-119(ed3) III. Show Description
vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
AUM2071 |
C. elegans |
vizSi32 II; unc-119(ed3) III. Show Description
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3 UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
AUM2073 |
C. elegans |
vizSi34 II; unc-119(ed3) III. Show Description
vizSi34 [cdk-2p::GFP::tbb-2 3 UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
AV106 |
C. elegans |
spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny.
|
|
AV112 |
C. elegans |
mre-11(ok179) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1
|
|
AV115 |
C. elegans |
msh-5(me23) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc msh-5 homozygotes, and dead eggs (nT1 homozygotes). msh-5 homozygotes give 97.9% dead eggs; of those that hatch, 42% are male.
|
|
AV125 |
C. elegans |
spe-8(hc40) I; dpy-4(e1166) IV. Show Description
Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy.
|
|
AV146 |
C. elegans |
chk-2(me64) rol-9(sc148)/unc-51(e369) rol-9(sc148) V. Show Description
Heterozygotes are fertile Rollers and segregate fertile non-Rollers (heterozygote), Unc Rollers (unc-51 homozygotes), and non-Unc Rollers that give 96-97% dead eggs (a high % of the survivors are males).
|
|
AV157 |
C. elegans |
spo-11(me44)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc spo-11(me44) homozygotes, and dead eggs (nT1 homozygotes). spo-11(me44) homozygotes are viable and produce more than 90% dead eggs (a large fraction of the survivors are males strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc.
|
|
AV221 |
C. elegans |
unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Show Description
meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.
|
|
AV267 |
C. elegans |
syp-3(me42)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.
|
|
AV271 |
C. elegans |
him-3(me80)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc.
|
|
AV276 |
C. elegans |
syp-2(ok307) V/nT1 [unc-?(n754) let-?(m435)] (IV;V). Show Description
Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes.
|
|
AV280 |
C. elegans |
unc-119(e2498) III; him-17(ok424) V; meIs5. Show Description
meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped.
|
|
AV307 |
C. elegans |
syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine.
|
|
AV308 |
C. elegans |
him-14(it21)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, DpyUncs (mnC1 homozygotes), and him-14 homozygotes that produce >95% dead embryos and 45% males. Among these surviving progeny, cytologically they have 12 univalents in diakinesis-stage oocytes owing to a failure to form crossovers during meiosis.
|
|
AV311 |
C. elegans |
dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.
|
|
AV38 |
C. elegans |
mnDp66 (X;I); meDf2 X. Show Description
Produces 31% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf2 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf2/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf2 can be followed in heterozygotes by this weak Him phenotype.
|
|
AV39 |
C. elegans |
mnDp66 (X;I); meDf3 X. Show Description
Produces 32% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf3 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf3/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf3 can be followed in heterozygotes by this weak Him phenotype.
|
|
AV40 |
C. elegans |
mnDp66 (X;I); meDf4 X. Show Description
Produces 27% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf4 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf4/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf4 can be followed in heterozygotes by this weak Him phenotype.
|
|
AV41 |
C. elegans |
mnDp66 (X;I); meDf5 X. Show Description
Produces 32% XO male self-progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf5 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf5/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf5 can be followed in heterozygotes by this weak Him phenotype.
|
|
AV473 |
C. elegans |
rad-50(ok197) V/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok197 homozygotes (viable, sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. rad-50 homozygotes are viable, produce more than 95% dead eggs and a large fraction of the survivors are male (Him phenotype). Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Reference: Hayashi M, et al. PLoS Genet. 2007 Nov;3(11):e191.
|
|
AV477 |
C. elegans |
dsb-2(me96) II. Show Description
Age-dependent defect in meiotic double-strand break formation. Homozygous mutants produce elevated frequency of males and dead embryos resulting from defects in meiotic chromosome segregation. The frequency of both males and dead embryos increases in later broods. Reference: Rosu S, et al. PLoS Genet. 2013;9(8):e1003674.
|
|
AV51 |
C. elegans |
me8 X. Show Description
Homozygotes produce 10-15% XO male self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. me8 disrupts the function of the cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment.
|
|
AV554 |
C. elegans |
dpy-13(e184) unc-5(ox171) IV/nT1 [qIs51] (IV;V); krIs14 V/nT1 [qIs51] (IV;V). Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
|
|
AV630 |
C. elegans |
meIs8 II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
AV828 |
C. elegans |
nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
|
|
AV860 |
C. elegans |
nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
|
|
AVS310 |
C. elegans |
artEx27. Show Description
artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
AVS394 |
C. elegans |
artEx12. Show Description
artEx12 [hpk-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional fusion of hpk-1 promoter with GFP. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
AVS397 |
C elegans |
gpIs1; artEx35. Show Description
gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
AVS408 |
C. elegans |
artEx31. Show Description
artEx31 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick mCherry+ animals to maintain. sur-5 driven over-expression of hpk-1. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
AVS411 |
C elegans |
artEx30. Show Description
artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
AVS413 |
C. elegans |
hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
|
|
AWR41 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR45 |
C. elegans |
pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|
AWR54 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR56 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR58 |
C. elegans |
lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
|
|
AWR59 |
C. elegans |
keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
|
|