More Fields
Strain Species Genotype
AV477 C. elegans dsb-2(me96) II. Show Description
Age-dependent defect in meiotic double-strand break formation. Homozygous mutants produce elevated frequency of males and dead embryos resulting from defects in meiotic chromosome segregation. The frequency of both males and dead embryos increases in later broods. Reference: Rosu S, et al. PLoS Genet. 2013;9(8):e1003674.
AV51 C. elegans me8 X. Show Description
Homozygotes produce 10-15% XO male self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. me8 disrupts the function of the cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment.
AV630 C. elegans meIs8 II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
AV828 C. elegans nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87.
AV860 C. elegans nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452.
AVS310 C. elegans artEx27. Show Description
artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS394 C. elegans artEx12. Show Description
artEx12 [hpk-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional fusion of hpk-1 promoter with GFP. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS397 C elegans gpIs1; artEx35. Show Description
gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS408 C. elegans artEx31. Show Description
artEx31 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick mCherry+ animals to maintain. sur-5 driven over-expression of hpk-1. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS411 C elegans artEx30. Show Description
artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AVS413 C. elegans hpk-1(pk1393) X; artEx29. Show Description
artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188.
AWR41 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR45 C. elegans pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR54 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR56 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR58 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR59 C. elegans keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR61 C. elegans keaSi11 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR62 C. elegans keaSi9 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR63 C. elegans keaSi12 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR64 C. elegans kea15 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR73 C. elegans aaim-1(kea22) X. Show Description
aaim-1 mutants are resistant to infection by N. parisii, but sensitive to infection by Pseudomonas aeruginosa PA14. No defects in development or lifespan were observed. Reference: Tamim El Jarkass H, et al. eLife. 2022;11:e72458. PMID: 34994689.
AX1295 C. elegans gcy-35(ok769) I. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1296 C. elegans gcy-36(db42) X. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1297 C. elegans gcy-36(db66) X. Show Description
Supresses aggregation and bordering phenotypes of npr-1(null) animals.
AX1305 C. elegans gcy-34(ok1012) V; npr-1(ad609) X. Show Description
Does not supress aggregation and bordering phenotypes of npr-1(null) animals.
AX1410 C. elegans flp-18(db99) X. Show Description
Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1789 C. elegans dbEx719. Show Description
dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1791 C. elegans npr-5(ok1583) V; dbEx720. Show Description
dbEx720 [npr-5::npr-5(cDNA) + unc-122p::GFP]. Pick GFP+ to maintain. Intestinal fat accumulation is similar to wild-type. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX1792 C. elegans dbEx721. Show Description
dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
AX2061 C. elegans dbEx813. Show Description
dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10.
AX2159 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx723. Show Description
dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2164 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx725. Show Description
dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2178 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx726. Show Description
dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX301 C. elegans npr-1(ad609) lin-15B&lin-15A(n765) X; dbEx35. Show Description
dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929.
AX7884 C. elegans pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Show Description
Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017.
AY131 C. elegans zcIs4 V; vit-1(ac2) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY132 C. elegans zcIs4 V; vit-2(ac3) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY133 C. elegans zcIs4 V; vit-4(ac4) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY134 C. elegans zcIs4 V; vit-5(ac5) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-5(ac5) is a dominant allele that causes ER stress. Since vit-5 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY135 C. elegans zcIs4 V; vit-6(ac6) X. Show Description
zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY142 C. elegans vit-2(ac3) X. Show Description
vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY143 C. elegans flp-21(ok889) V; flp-18(gk3063) X. Show Description
Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4.
AY145 C. elegans kyIs262 IV; acEx24. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY146 C. elegans kyIs262 IV; acEx25. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY147 C. elegans acEx26. Show Description
acEx26 [odr-1p::RFP]. Pick RFP+ to maintain. RFP expression in AWC and AWB. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
AY156 C. elegans acIs156. Show Description
acIs156 [vit-2p::vit-2(G839R)::GFP + myo-2p::mCherry]. In contrast to VIT-2::GFP, VIT-2(G839R)::GFP remains in the intestine and is not transported to embryos. mCherry expression in pharynx. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.
AY157 C. elegans gon-2(q388) I; acEx157. Show Description
acEx157 [gon-2p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in intestine and gonads). gon-2 expression driven by gon-2 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY158 C. elegans gon-2(q388) I; acEx158. Show Description
acEx158 [ges-1p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in intestinal cells). gon-2 expression driven by ges-1 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935
AY159 C. elegans gtl-2(n2618) IV; acEx159. Show Description
acEx159 [gtl-2p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in the excretory cell and pharynx). gtl-2 expression driven by gtl-2 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935