SS615 |
C. elegans |
pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. Show Description
Dpy Unc. Temperature sensitive. Maintain at 15C. Grows very slowly.
|
|
SS617 |
C. elegans |
pgl-1(ct131) him-3(e1147) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. Show Description
Throws males. Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.
|
|
SS618 |
C. elegans |
pgl-1(ct131) him-3(e1147) IV; pgl-3(bn104) V. Show Description
Throws males. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.
|
|
SS727 |
C. elegans |
pgl-2(bn123) III. Show Description
Fertile at all temperatures.
|
|
SS729 |
C. elegans |
pgl-2(bn123) III; pgl-1(ct131) him-3(e1147) IV. Show Description
Throws males. Maintain at 15C. Sterile at higher temperatures.
|
|
SS730 |
C. elegans |
pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV. Show Description
Unc. Maintain at 15C. Sterile at higher temperatures.
|
|
SS731 |
C. elegans |
pgl-2(bn123) III; pgl-3(bn104) dpy-11(e224) V. Show Description
Dpy. Fertile at all temperatures.
|
|
SS733 |
C. elegans |
pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V. Show Description
Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.
|
|
SSM72 |
C. elegans |
exo-1(tm1842) III. Show Description
Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47.
|
|
ST101 |
C. elegans |
ncIs1. Show Description
ncIs1 [eat-20::GFP + rol-6(su1006)]. Rollers.
|
|
ST2 |
C. elegans |
ncIs2 II. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. No morphological or behavioral phenotypes.
|
|
ST2351 |
C. elegans |
ncEx2351. Show Description
ncEx2351 [unc-47p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST2365 |
C. elegans |
ncEx2365. Show Description
ncEx2365 [del-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST2371 |
C. elegans |
ncEx2371. Show Description
ncEx2371 [acr-5p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST3003 |
C. elegans |
ncEx3003. Show Description
ncEx3003 [hsp16-2p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST3026 |
C. elegans |
ncEx3026. Show Description
ncEx3026 [aex-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST3031 |
C. elegans |
ncEx3031. Show Description
ncEx3031 [myo-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST3034 |
C. elegans |
ncEx3034. Show Description
ncEx3034 [F25B3.3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST3090 |
C. elegans |
ncEx3090. Show Description
ncEx3090 [tph-1p::Arch::eGFP + (pCFJ90) myo-2p::mCherry]. Pick GFP+mCherry+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
|
|
ST53 |
C. elegans |
ncIs3 III; him-5(e1490) V. Show Description
ncIs3 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. No morphological or behavioral phenotypes.
|
|
ST65 |
C. elegans |
ncIs13. Show Description
ncIs13 [ajm-1::GFP].
|
|
STE68 |
C. elegans |
nhr-49(nr2041) I. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
|
|
STE69 |
C. elegans |
nhr-66(ok940) IV. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
|
|
STE70 |
C. elegans |
nhr-80(tm1011) III. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
|
|
STE71 |
C. elegans |
nhr-13(gk796) V. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
|
|
STE72 |
C. elegans |
nhr-80(tm1011) III; nhr-66(ok940) IV. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
|
|
STE73 |
C. elegans |
nhr-80(tm1011) III; nhr-13(gk796) V. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
|
|
SU295 |
C. elegans |
jcIs25. Show Description
jcIs25 [pPE103 (jac-1::GFP) + rol-6(su1006)]. Rollers. Reference: Pettitt et al. 2003. LCB 162:15-22.
|
|
SV327 |
C. elegans |
cdc-14(he118) II. Show Description
Extra cell divisions within several cell lineages.
|
|
SV557 |
C. elegans |
cdc-14(he141) II. Show Description
Extra cell divisions within several cell lineages.
|
|
SX157 |
C. elegans |
prg-1(n4357) I; unc-22(st136) IV. Show Description
Transposon silencing normal.
|
|
SX166 |
C. elegans |
prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. Show Description
Transposon silencing normal.
|
|
SX178 |
C. elegans |
prg-1(n4357) I; unc-22(r765) IV. Show Description
Twitching due to transposon insertion in unc-22.
|
|
SX2650 |
C. elegans |
mjSi74 I. Show Description
mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
|
|
SX278 |
C. elegans |
prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. Show Description
Transposon silencing normal.
|
|
SX328 |
C. elegans |
mjIs17 IV. Show Description
mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].
|
|
SX333 |
C. elegans |
mjIs11 III; mjIs17 IV. Show Description
mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].
|
|
SX392 |
C. elegans |
mjEx142. Show Description
mjEx142 [mir-124p::mCherry]. Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.
|
|
SX494 |
C. elegans |
prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. Show Description
Transposon silencing abnormal. Twitchers.
|
|
SX523 |
C. elegans |
prg-1(n4357) I; prg-2(n4358) IV. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
|
|
SX921 |
C. elegans |
prg-2(n4358) IV. Show Description
Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.
|
|
SX922 |
C. elegans |
prg-1(n4357) I. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.
|
|
SYS1050 |
C. elegans |
ujIs113 II; lin-22(dev259([mNeonGreen::lin-22]) IV. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-22 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS397 |
C. elegans |
ujIs113 II; ceh-51(dev72([mNeonGreen::ceh-51]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-51 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS398 |
C. elegans |
ujIs113 II; lin-32(dev70([mNeonGreen::lin-32]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-32 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS400 |
C. elegans |
ujIs113 II; tbx-37(dev91([mNeonGreen::tbx-37]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of tbx-37 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS412 |
C. elegans |
ujIs113 II; elt-2(dev99([mNeonGreen::elt-2]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of elt-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS423 |
C. elegans |
ujIs113 II; F19F10.9(dev94([mNeonGreen::F19F10.9]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of F19F10.9 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS424 |
C. elegans |
ceh-5(dev103([mNeonGreen::ceh-5]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
SYS427 |
C. elegans |
ujIs113 II; ceh-10(dev101([mNeonGreen::ceh-10]) III. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-10 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|